Transcript Name :
Phyra_g32
Orientation:
(-)
Number of Exons:
4
Description :
RAW41886.1 hypothetical protein PC110_g1871 [Phytophthora cactorum
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-510
NN-scoreoddsWeighted Score
0.6481.550.003
*** None ***
TypeScore
mitochondrial82.6
GO
*** None ***
*** None ***
*** None ***
Sequence
        1716 bases(100 bases per row)
TGAAGACTCGGCGCGCCCACCGACGCAAACTGCGCTTCAGCTCCGCGAAGGACGCCGCCCCCGTGGCGACCGTCAAGGCGGAGCACGCTCCCAAGCGACC
AGTGAAGCGGCGCAAACGCCAGCATCACTCGCGTCACGTCAGCCCCGTGCCGAGCAGCACAGCGCGACACCCGAACGGCCTTCCAACAGCGACTTGGAGC
AACATCCAGGAACGATTCGCGGCTGCCAAGAGTCTGGGGGAAATGTACGACGCCAGAGCTGGCGACTGCAACGAGGAAGGCTCTAAACTGTGACTTGCTC
TGGCAGAACGCGCACCACGTTACAGTTTTTCAAGGAGCACGAGGAGCTGCAAGGCTTAGCCGCAGTTCCGGTCTTCCCGATCTTTGTTCCCGCGAGTGAA
ATCTACAGAATGAAGGGTATTGCGCGTGTGCTCCGTCGTTCTTGGTGCGTGGTGGTTTCGACTCTGATGAACGCTGCGTAGTGCCGAGGAAGAGAAGGAT
CTACGACGTGCTCCACGTACTGGAAGGTATGCTATTTGTACGTCCCTGCTGGTTTGAGCATTGATACGATGCGGCGCCTGCAGGGGTTGGAGTGATCAAG
CGCGCGAGGTGGGGTGAGGTTAGGAGGAGGACCAGAGGCGGCTACTTCTTGTACTACGGGAAGGCCGCAATGATCCAGCACCTAGCAGAGATGAAGAGCA
ACTCGGCACAAGTCATGCTGAATTTTCGCCAGTCTTGCAGTTCGAGAGTGGCCACTGCCGTGGAGGAGGATAGTTTTCTCGTCAAGGCTTTCGAGGACCA
GGCATCACTTGAAAATTGGCCGTGTCTAGTAACTGCGACGGCCTGCTTCCTCGCGTTGTTGTTTCAGCGAGACTACCAGGTCCTAGTGGCGCTACCCGAC
ATGAGTGATCGGCTGATTGAGGCGAAGAAGTTTATCGGTGCCTCGGTACCGGGTTCGGCGCGAAACGAGTCTCCGTACAGTGATGTGCAACGCCGCATGT
ATGACGTGGTGTCGGTGTTGGAAGGTTGCAATTTGATCCTCACCTCAGCCTCGGCAGACAAGTCGCTTGAGTCACCACTCGATTCTACTGGCAAGGGCTA
TCAACGAAAGCACATCCGGTTCAACTACGACATCTTTACGGACCTGAGCGTGCTGCTTACAACTAGTCATCCCAAGACGTTGCAGTGGAATGGTAACTCA
AATCACGAAGAGCTGTTCGTTGGAACGAGTGTTAGTCCGCGTGCGTGGCAGAGTCCAAAACTACCTTTTGAAGAGTCCATTGTCGTCTCTCCACCATCGG
CGTGCTGGCAAAGGCTTGATGGTGCTGTGAATCTTAACACCTCCCCTACTTTTACCCCCACGAGGTACCAACCAGAAGCACAGCAAACCATCCGCGTCCA
AGACCTTTTTTCGCCTCTTGGCAAGGAGCCTGCAGTGAAGAATGAGTGGTGTGACGAATCACTGACGCAGCTTGGGCTCTACGATGCGCTTTCAAGACAA
TATCAGATCGACTGGGAGCTGAACAAACAGTTCAAGGATATTTATCGTGAGATGTGGGGTTCTTACAGCATGCCAGCTTCCATTGCGAATGCGTCCGTCG
AGGTGCAGTCACACAGATGTTGGATTGACAACGTGGACGTGAAGTTGGCCGACCTCAAGTGCCATGAAGTACCGGCAGAGGACGAAGGTGGTACGACAGC
CAACTTCTTCTGTTGA