Transcript Name :
Phyra_g181
Orientation:
(+)
Number of Exons:
3
Description :
OWZ24106.1 RxLR effector protein [Phytophthora megakarya
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ubiquitin domain20.697PS50053
HmmSmart predictionP-Valprediction_id
Ubiquitin domain8.8e-21SM00213
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-691
*** None ***
PositionContextScore
173SRSRQRR|TA0.732
284RHHRRNR|DG0.543
297GRQRHGR|RS0.507
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        2589 bases(100 bases per row)
ATGGCCACGCCGACCGACCCGCTGTCGGAGCCTGCGGCCGAGCCTCCTGTGGCCGCAGAGGCCGCGCGACTATCGCTCAAGGTGCGCACACTGGATCAGA
AGACGTACCCGATCACCATCTGCGCGGCCGCCTCTGTGCCGCAGCTCAAGGAGGTCGTGGCCGCCGAGACGGGCATCACACTGGCCCGCCAGAGACTCAT
TTACCGTGGCCGAGTGCTCAAGAACGACCAGTCGCTGGCTGCGTACTCGCTGGAGGATGGCCACGTGCTGCACTTGGTGGTGCGTGCCGCTCCGCTGCCG
TCTGCTGGCGTTGCTGCTGCCGGCCACGGATCGGCCGATTCTTCTGCTCCGGACGCTGATGCTGGCCAGGCTGGGCGAGCCTCTGACCACACTGCTGCTG
CACACCAGTACTTGGCTACAGGATTCAGCTCAATGAACGGCATGGACGCGCTGAATGCGCGGCTGGACGAGTTGCAGAGACTGTCTCAACGCGCGCGGTC
GAGATCGCGTCAACGTCGAACAGCTCGTATGCCGCTGCCGCCGACAGATAATGATGAACCTGACCCGACCATGGGACGCCCGGGCGGTGGAATCCCCAGC
CGCGTGCTCATGGGCGCTACCATTTCGGTGCCTGAAGGGGCCAATGTTACCATGCCCTTCCTCAGCTCCATGATCGCCAACCTTGTCACGCAGGTTCATG
AAGGTGGCGTGGAAGGCGAAGGAGTGACGACAGGAACCGCTGCAGATGGACGACATCATGTGTCGTTCTCGAGTGAGGCCCTGGGTGGGGTCGCTGCTGC
TGAAATGGGAGCGACCGCGGCGAGAGCGCTGCGCCACCACCGCCGGAATCGCGATGGATCGGGTAGTACGGGACGTCAACGCCATGGGCGACGTTCTTTT
ACTGGTGCTGGGCGTCAGGAAGCTTTGCGAGTTCGTACGGGTGTACTGTTCGCGTCGATGCGTGCGACGCTGGATGACGCGTCTCTCAATTTCCCAGCCG
AGCTCGCCGCACTGCCGCAAGGAGGGGACAATGCAGCTATGGCAGAACTGCAGCAGCAAGTGGAAATGCTGCTAACGCTGCTGGAGCGGTTTGGGCCACG
ACTTCGCCTTCTTCCTGCTGCGCTTGCCCAGCGAGACCGTCTGACTGAGCGCTCTGCTCTAGCGGCTAGTGGTACGGCGCCAGTTGAGTCAGCTTCAGGC
AGCAGTAGCACACCCAACACGACCAATGACCCAGCAGAGCCAACAGTATCAACACGCCATGTGATTCGTGCGATCGAGACGCTGCAATCGATCGGAGAGG
CCACTGACTTGCTGGCGCGCATGGTGCGCCATGCGTTTGTTCACCAACCCATACAGTTGCGCGAACCCATTCCGTTCCGTGAAGATGCTGCCGGTGCTGC
GAATTTAGGTGCTACTATTGCTGGTGACGGAGTAGATGCCGCGATGCAAGCAGCGAGTCGCACTGCAGGTGCTCACGCTACTACTGGTGACAGAGTGATT
GCTGCGATGCATGCAGCTGCACGAAGCGAAGGAGGTGTTCGACCTCGGTTTCGAGTGTCTCGAGTCAGGGCTATGGATCTGCTGGGCGAACGAACTATTA
CAGCGTCGAGAACGGGCAACACTGCTCCAGGATCGACCCCAGGCTTCCCAGTAGATCTAACGGGCTCTTCTACTCGTGCAGCGCCACCGGTGCCCCAGTT
GGCAACTTCCGCAGATAGCAGTCGACCAAACACGCGAGCTGATGCAGCTCCAAACAATAGTATGGATCCTCAACTGCCTGCAGGTGCGCGCATCTCGATT
CCGGGCATCGGTGGACTGCCTCTCATGTCTTCGGTAGTGTTCCCATACTCTCTGGCAGCCGGCCTAGGCGGTAGCCATGCTACTACGACCTGGAACCTGG
CGGATTTTGTAAGCCGGCTAACCAGTGAGCTGCCAATTTCCACTATCTACGGAGTCATGGCGGGTGATGCCACCCATCTACACCAGATCATGGCGCACAT
TGGCTTCGCTTTGTTCAGCGGCGTTGACGTTCCGCGGATATCAAGACCGAACCTTCGTGCTTGGGCCCAAGACCTTGTAGACGAACTCCGCCGTTTGTTG
CGCTCGAATGCGCTGCCTGCAGACGTGCTGGATCAAGTGAATGGAGAGACTGAGCGACGCTCAGCGCTGGGGAACGAGCTTCTTCGTGTTATGGAGCCGT
TTATCCCTGACCTCATCGACTACCTCGTCCGTGCCACGTCAGCTAGTCGGGTCGCTGCATTTGGAACCAGCAGCTCAACATTTTTGCGTACAATGGTCCG
GCAAGTTGTCCACCAACTCCGTTCCTACGCAAGAGACTCGACAGAATCCGAAGACGAGAGCGACGAGCGATTGAAGCGTCTGCTGCGAGGACTACTAATC
TGGTTCGGCATGAACGAGCACATGGCGGGCTTTGTCGTTGACAGTCTTCTATGCTGGACTGAAGGAGATGGCGCTTCAAGTCGTCGCGGACGTACGCGCC
AACGCGAGGACGCTACTAGCGGAGCTGGTGCTACTGACTCGTCTGCAACCAAGCGGCGACGTGAGTAAGACGTCAAAGGAGCTGCTGTA