Transcript Name :
Phyra_g19
Orientation:
(+)
Number of Exons:
8
Description :
XP_009515381.1 hypothetical protein PHYSODRAFT_554382 [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
MIT0.00011SM00745
AAA+ ATPase domain3.5e-22SM00382
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
MITIPR007330
*** None ***
InsideOutsideTMhelix
1-391
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        1806 bases(100 bases per row)
ATGTTCTTGTGGCGCGGTCGACAGCCCCAGGACGCGATCCAGAAGGCGATCGAGGCAGCCGTGGCGGCGGACAAAGCGGGGAAGTATCAGGAGGCGGTGG
GCCTGTACGCGTCGGGAATCGAGAAAATGATGGCGCAGCTGGCGCGTATGTTGAAGCCGTTAGAAGCTGCTCTTGTGTGTCTTTCTGAGGTGTTTTGAGT
GATTTTATCCGACTGCAGATCTGCAGGACGAGGAATCCAAGACGCGCATGCGGCGGAAGATCAACGAGTACATGCAGAGGGCCGAGTACCTCAAGGACTG
GACGGCGGAACAAGCGCGCAAGCAGCAGACGCAGGTTGGCGGCGAGACTGGAAGGAGATTCCACCAAGGGGGAAGCTTCTGATTGTGTTTTTTTGTTATG
TTGCTGGATATAGGATGCACCGCCGTCAGCTGAACAGGAGGGACGCACTGCAAGTGACCGGCAGGTTTAGAAAGTTATACATGACAAGTTGCAGCTGAAG
TTTTTTTCGTTGCTGACGTTCGTTGTTGTTGACTTTTTGCAGCAACTGAGAGCGGGGTACTCGAAACAGCATGCGGAGCATGCACATACCATTTTAGACG
AGGTGATGGACCACTCACCAGGAGTGCATTGGACGGATATTGCTGGGCTGGACGTTGCAAAGCAGATTTTGCAGGTTTGGCAACAGGGATTGCATGTCCT
ATTTGATCTGTGTTATGGTGTTAAGCATGGACGTGGTGTGAGGTAGGAAGCTGTCATTTTGCCGACGTTGCGTCCCGACTTATTCACGGGCTTGCGAGCT
CCGCCTCGTGGAGTACTGCTCTTTGGACCTCCAGGCACAGGTATGTGCTTGTCGTGTTTTGCACGTGATACGAACTGCTTTCACTTCTTGCCTTGATGTT
GCTAGGAAAAACGTTGCTGGCGAAGGCTGTCGCTACAGAGGCGAATGCAACATTCTTCAAGTATGCAGCTACGTATTGACTGTTGACCGATATGCGTTGC
TGACGGATGCTGTTGTAGTATTTCCGCGTCATCACTGACGTCCAAGTGGGTGGGAGAAGGTGAAAAGCTAGTGCGAGCGCTTTTTGAGATGGCTCGGGAG
CTCCAGCCTTCTGTAGTTTTTATGGACGAAATCGACGCTTTGCTGTCGACAAGGTCAGCGTCTGAAAACGATGCAAGTCGCAGAATTAAGAACCAGGTAC
AGCCCCAGCGCCACACCATTTGCAGTGCAATATGCTGACATATTCTACTGTAACTGCCAATGCAGTTTTTCACTGAGCTTGACGGAGCAGCATCGTCCCA
GGAGGATCGAATCCTTGTCATGGGAGCAACGAATCTCCCTCAGGAACTCGACGAAGCTATCGTACGACGCCTGGAGAAGCGCATTTACGGTACGCAGTGT
CTGCCTTTCCGCAGTGGGAACCCGTGTATTGCCCTCACAGGCGTTTAACATGCTTTTGATGAACCATCACCTCAGTGCCCCTCCCGGATTCTACTTCTCG
GGAAGGACTTATCCGGCGCTTGCTTAGTAGCCAGAAATTCTCCTTGTCGTCAAAGGATGTCAAGCACATCGTCAAGGCGACTGACCGTTACTCTGGCAGT
GATCTCAAGGCTGTGTGCAAGGATGCCGCGTTAGGTCCCATTCGCGAGCTGGGGGCAAAAGTTGCTGACGTAAAAACCGAGGATGTGCGCGAGATCAACG
CATCTGACTTCCAGGTGGCACTCACACGAGTCCGACCAAGTGTGTCCTCGACAACAATAGAGGCTTTGGTCGCGTGGAACGAACAATACGGAGTGTCCGC
AGTATG