Transcript Name :
Phyra_g571
Orientation:
(-)
Number of Exons:
8
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Integrase, catalytic core13.527PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-642
NN-scoreoddsWeighted Score
0.5121.2360.002
PositionContextScore
13SWKRFAR|EL0.586
TypeScore
cytoplasmic52.2
GO
Biological ProcessGO IDPrediction Method
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        2943 bases(100 bases per row)
TGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTG
TGAAGCAGAAGAGTTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTC
AAGGAGAGACCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCACAGGACAAGGGTGTTCAGCACGAGA
TTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGACGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAA
TGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAG
CTGAACGATGCGACGGTACCGGCACAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATAACCTCGAGTACTATCTTCAGTACTCTGGATCTGA
GAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCA
GGGGCTGAAGAACGCCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCAT
TCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAAC
CTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCA
ATGAATGGCCTACGCCTTCAAATGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCG
CCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCC
GATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGT
CGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCG
CAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAG
AATGGCACGGTGGCTGTCATTCTTTGCGGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCA
GATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCAC
ATGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTA
TCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTAC
GAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTACTGGAGTCACCAGTACAAGTGGGTAC
GCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAAATCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCA
GTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAAAAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTT
GCTGCAGTACCAGTCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGCATGCCACTCGACATCGTGTCGGATC
GGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCAGATCACCCGCAGACCGACGGACA
AACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACGGCTTGCCGATGGCGGAGTTCGCCAGC
AACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCTTGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCT
TAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGTATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAG
TCATAGCGACGACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAA
CCGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGCCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGAC
AGAAGCTGAATGCCGATAACACCGGCACAGGAAACACAAATGA