Transcript Name :
Phyra_g14
Orientation:
(+)
Number of Exons:
14
Description :
RAW36049.1 hypothetical protein PC110_g7680 [Phytophthora cactorum
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2111
*** None ***
PositionContextScore
1920VRSRLKR|IL0.707
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        10056 bases(100 bases per row)
ATGACGCCGCCTGCGGACGGCGATAGCGGCGAGTTGAGCGCGTCTGCGGCAGTCCCGGAGCTGCATACGCCGTCCAATGTGGCTGTTCAGCCTTTGGAGC
AGTTGAACGAGGCGTCGACGACGCTGGAGGCCCCGGAAATGTCCTCAGAGGAGGAGGCGGACGAGATGGTGGAGGCGCTCGAAGACCTGATCCTGGAGGC
GTACAATAACATGCAAATCGATGGCGAGTACATATTCCTGCCGGACGAAGTGGCGGAGAAGCTCCATCGCGTTGCGGAGCAGGTGCGTGCGCTTGGTGAG
CAGATTAGGAGAACGAGGATCTGATTTGGTGGCTGTGTGGCTTAGATGAAGACGCAAGTGGACCAGGAGAGCGTGGAGGAGGAGCAGACGGAAAATAATA
CCAGTGCTGGGGAAGATAGCAGCAGTGGCGATGGTGCAATTAGTAAAATTGTGCTGGAAGCGGTGAATGTTCCGCAACAGCAGGAGGAGGCGCCGACGGA
TCGACCAGAACCTGAACAGGAGCAAGAGCAGGAGGAGCAACAGGTCCAGGAGAAGAAAGAGGATAATTTTCAGGGACAGCGTGAAAGTAGCACGAGTGAG
GATGAGGAAGCAAGGCTCCGCAAGGTGCAGGCGTTGCAGGCCGAGGCGGCGGAGCTGCGCGAAGAGAAGCACAAGCAGCGAATTCCCAGGGTGATGTCCA
CAGAGAATCTCTTTACTGAGCTCGCACCCGTCCCTGAGATAGATGAAAGTGCGTCGAGTGGTCCACCATCACCTTCTCCTCCACACTCTCGCGCGGTTAG
TGGCGCAAACACTCCAAAGCCAAGGGTCCACACACCGACACGAGGACATGGCCGCTATCCTCCACCGCCACTGATTTCGTTGAGCTCTACCCCGAGTAGT
GCAGCGGCAAGTCCTGACCAAATCGGAAAGTCCCCAGCGTCCAGAACACCAGACCAGTCTGGTGGTAACAAACGGAAGGGTAAGGTCGTCACTTACGAAA
AGAGAAGGGAGGCCGCTCTGAAGCTCAGAGAGGACAAGAAGAAGCGGGAGCTACGCATCCGCGAATCTGCACGCAAACAGCGTGAAGACGCTAAGCGACA
ACTCGAGGAAGTGCATCAAAAAGAGATGGAGGAAAAGCGCGAGCGTGTTAGGCGTATTCGAGAAGAGCGGCTCCACCGTCGCACAGAGAAAGCAACAGGC
GCAAAGGGTACTTCAAAGAAGGATGAATAGTCGGGAGTTTTCATGAGGGGTAGTGTCGAATGTACATACTACTCGTTAGATGGCAAAGTATGTTCTGCGT
GTGTGTGTCATGCTACCGGTAGATTTCTTTCTTCAATTTCTGGTTGTTTGAGGCACTCTGGAGCTGATCTAGCGTTTCTGGATCCAACTCACGGAGAAGC
GATTGGATTCCGTCGAGCGAGCAACTCAAAACTTCTGCTTCACGCCGCAAGTTTGCCTTTTGCTCGTCTAGGAGATTTTGGCGGTGCTTCAGTCGATTTA
ATTTCTCGACGTACTTGAACTGTCGAGACTCCAATTTGCTGTCAGAATAGGAACACAAAGGCAGTATTTTCAGGCGAGTCAGTTTGTGACCTGCAAAGTA
TGTGGCACGCCGAGGTGCGCACCTGGAATACCGATTCAGCTCGTGGACACAGTATTTTGCATACTGACACGAAAGCTGCAGCAGACCCAGCGCCTTCGCG
ATGCCGTCGCTAGAATTTTTCACACTATTTGAGCTGGTACGTCCAGTATTCGCCCGACCGTAGAGCGTCAATGGCAGCAAGTCGTACAGAATATCGGTGC
GGACCTGCTTGCCAGTAGCATATCACACTGCCTTAGTTTTCCGTGTGCGCATCAACCGTCATTGTATCCAATGAGGAAAGACGTACCTCATGAACAATTT
GACCAACACGAATAGCACGGAGTTTGCCGCCTCTAAGTGAGCGACGAGGAAGGACGAACTGGAATGGCTTTTTGTGTGCAGAGTCCTTTTCCATTACTGA
TGTCGCTGCATCTGGTGGCGGTTCACTTTTTTTTTCAGGCAAGTCTTCCACGCCTGCAAAGGCGACGTACAAATAAGTTGCCGAGCACTGCACTTCAACC
TCGTTTTCACAATACTCGCGTCCATCCATATCTAACTTTAGTTTTCCTTGTCTTTCTTCTCTGCAATTCTTGATCTCATACCAGCGCTGCTGTGCTTCGA
ACTTGCTCCACTTCGCCAAGTCCACACTCCACCCAGTGAGAAACTGAAGCAACTCCGTCGCGCGAGACTCGCCCTCCCACAGCTCAAAGCGGATACTGGT
ACCTTCGTTCGTCTGGCCCTGCAAATCCACCTCAAGCCCTTCCTTCCACTCGCCCCCACAGCGTAGACACCTTTCCAGCAAGACGTGATCCCTACCAACC
ACAGCCCAGCCAACCATTTTAGCAATTCTTATCGACCAAAGCACAGCCATGCACCCGCACCCTTCACTCCGAATCCGCAGCCACAGCCATCCTCCAGCCC
AGCGCCCGACGCCGCGCACGCCCAGCATCATTTTCTTCAAACGTCGTCGACTATTGAAACGTACTTAGTCGAGCTTTTGGTCCGAGAAACGATGTCCCTT
TCGTGATACTAGAGTGTATTGGGTGTCCTAGAATCAATGTTCCCTTTCGTGACTGGCGTGTACTGGGTAGACCTGGCATAGTCAACCCAAGTCAAAAGCG
CGGAAAGAACCATTCCGCACTCATCTTCCGACTGGTCGTCAGTTCCAATTGAGCAAGATGGTGGCGATCCGTGGCAAGAAGGCCAAGGCGTCGGCCAAGC
CCAAGGCGGTGGAGAAGGCGTCGAAGGCCAAGGTGGCCGCTGCCGCCAAGGAGGTCGCGAGCCCCACGCGCCTCACGCAGCAGCAGCAGCTCACGCGCCG
CCGCGAGCAGGAGTTCGTGGCGCTCGCGCGCTTCGCCCTGCAGAGCAACTTGGCGCGTGGTGCGGGACTGTTGGTCTCGAGTGTGTGCAACGCCCTGCTC
ACGGCTCTTTGTGCGTCTGGCAAAGAGAAGTCACTCGCGCCCACGCAGATCCTGGCCAAGCTGCCGCGTACCGAGCGGAAGCGCGTGTGCGGCGCCATCT
TCTCGGCCGACGAGGTCGCCTACAGCTGCCGCAACTGCCAGTTGGACACCACGTGCGTAATGTGCAAGGATTGCTTTACGCACAGCGACCACGCGGGACA
CGACGTCTACTTCCAGCGGACGACGGCGGGTAGCTCGTGTGACTGCGGAGATCTGCATGTAGGCTTGGTTTTTGTATAGGAATTTGGTATTATTGGAGCT
GACCTTTTTGTTGTGTTGGTAGGCATGGAAGCAGAGTGGCTTTTGCTCAAAGCACAAGGGAGCGGGGGTGTCGGGGAGTGGAGCCAAGAAGCACAAGCTG
CCGAAGCATGTGGGACTGATGGCGCCTATAGTGATTGAGACGGTGGTGGAGCATATATACCAAGTGTTGCTGGGCGTGGATTATGGATTTGAGCTGGCGC
AGGCCTTTGAGCTGTTTACGAGGGACATCCCGCCCCAGTTATTGCCGATTCAGAGTGATACGGATGTGGCAGACGCTTCGGAGAGCAGAAGCAGTCCAGC
AGGGTTGACGCGATCGAATCGATTGTCGGCGCAGTTTTCGGTTGAACCTGCAGCCAAAACTAATGGACCGGGTGGGCGACTCGAGGCACAGGCGAAAGAA
GTGAAGTGCGAGCCGAACTCGTCCAACGATGGCCGGAACGATGGAGTGCGTTTTGGGATTCGTCTGCACAATGACGACGTGCACTCATTGACTGATGTGA
TCAGCCATCTTTACGTGGAATTGGAAATATCCAAGACCCAGGCGCGTACGGCAGTTAACCGAGTGGATAACCAGGGAGATGCGACGATTTCGATAAAACC
ATTGCTCCAATGCCCGTCGGTAGTCGGGAACCTGGTTCGTCGCTCGTTGAATATCTCTGTGGCACCGACATGGTGGGAAAAGCAGATGGAAGAAGTACCT
GCCCTTCTGGAGTGGTTGCAGTTTGCGAGCACGACCTCAGATGGTCTCAGCGAGCTTGTTTCTGAAGCTTTTCAAAAGCAGCGGTCACGTGCTCTGACAG
GATTCCAACCTGTACCGAGTGATTTGCCCAAGGGCACGACCGTTCAAGAATTTGTGAAGGAACGACATATTCGTTTGCACAATAATGCTCTGGATGTGAT
TGTAGCACTAATTGGAGATGACAAGGACATTTTTACGTGGGCATCTGAACAAGAAGCGTCTCAGCGCCGGCGCTTTGATTTCCGAGCAGAAGGCGCCATT
TCGACTGTGACATCGGCAGGATTCCTTGCAGAAGGGAACCGCGTCAGCTGCAAAAACATATTTATTGAAGAGTTTGTGAAGGCCGTATCGCTGAGTCCCT
CTTATCGCCGCCATGAAAGTGTTCGAAAGAGCTTTGACGCGGTGGTGAATAAATACTTCACGTCGGAGCACGAAACATCTACGGACGTCCAAACAGTTAC
TTCTTCAGCTTTGACGCTGCTGATGCGATATGACTGTACCTTGCGAAAGAAGGCTGTGGAGCGATCGCATTCGTTTTTGCGTGAGCACTTGGTAGACATC
AACTTCAGAGCTAGCATGCTGGAAGCGTACTTGCGCTCATACGCCTCGATGACGAGCATGTTTCTTCGCGGGCTGGGCAACTCGACCGAATCCATTTTCG
ATTTCGCAGTGCAGTTCTTAACAGTACCTCATCTCGTCCAGAGCTACACGAAGAAGGAAGCAGTGGCGCATCCCGGGCGGCCAGAGCTGGTTCGTGAACT
TCTTTGCGCTCTGCACACAGTATTTCAATCTGCTGTTGAAAAAGAAGGGGCTTTAAACGCCGACCACGCTGCGTTAAGCAGCCAGAAGTACAAGGTAAGC
ATATTAGTTTGTTGGTTGGTGTGGTATTTCAGATGACCGGAGTACTCATCTTATCACGCGTTTTTTATGTTCGTTTTATCGTGTAGCACTGCGTGGAGAA
CATGGAATATGTTTTCAATATCGGTCCCACGCTTTCGAGCGAACTTGTGTGCAATGCGGACAACTTGAAGATCTGGTTATCCTGCTTGAGCATTCTGCAG
GTATGTACAATCTGGCCGGTTTTTTGCTGGAAATCCAATACTAAACATATTATGTCGTAGGGAGGGGATCCTCAAGTGCGCCGAGGAATTCACCAACCTC
ACGTGGAATACGAGTCAGACAGTTGGTTATCGATGTTTAACCTTGGTATCCGCGTCCACTCGGTGTTCGCGATCTCTTGGAATGGTTTTAGTCCGTCCCA
GTTCGAAACTCCCCTACTGAAGGTAGCTGAGATTTTCGGTCCTGTCATCGACGCCACTCTTTCATCATCAGATCGCCTAAACGACAAGGTGGCGAAAAAG
ACGTTGGTTCCGGTGGCGAGGCTGGTGTCTGCAAGCAAGAGGGGTGCTGGAAGTCGAGAGAAACCAATTTCGACCTACGACTTCAACGTGGCATCCCAAC
CAACTTCTCTGCACATCCCTTTGCACCGTTTCCTGACAGCGGCAGTGCGGCATATTTGCATTAGCCAATCAGGATTAGGAAGCTCAATCCCTGAGGACGG
TTTGCTGAGTGTATTTGGGCTCGACAAACTGTCGACTGATAAACAATGGGAGCTCGTGGAGATGCCTCTTCGATGCTTAGTGATGGCATCTCAGATTCAC
TCCAACCTGTGGCGCCGCAACGGGGATGAAAACATGCTGGCCCAGCTGTACAACTACTCGGCATTGCCGTACTGCATTCATTACCGCGACGCAGACGCGC
TGATGTTGCAGCTCAGTGTCCTTATGACGGGTCCTGATGCCCTTCTGGCACGAATGGTAGATCGGTTCCAACTTGGCAGTTTTTTCGTGCAGCCGAAGGG
GAATTCAAATCCTGCTACTAACGATGGCTCGGGTGAATTAGACGATTTGGTGAAACAGTTTGGATACTCTCCGTTGGAGCAAGGTATTGACGAGCAGCAA
CGCCTACAAATGCTAGAGGAGTTCCTACGGCTCGTGATCGTACTCGGCACAAGCCTTCCGAACTCGACAGGTGCGGTGTACGACAATGAATTTCTCGCAG
AAGAGATGTTGCAGCAATTGTGCGCCAAGTCTCTCCCGTTCAGCAAGCTGTTCGACCTCGCTATTTTGCCGTCCGGCCAAGATGACATTCCTACTGCACG
ACTGGAAGGTGTTCTTGCAAAGGTGTCCGATTTTGTGCCACCGTCGGGTCTTGAACCGGGTCACTATGCATTGAAGGAAGGGTTATTGGAGAGTTACAAC
CCGTACTTCCTTCACTTGAACCGTGAGGCGCACGAATTGGCTCGTGATCGTTGGACAACTTATCGCAACGCATGCCGCCAGAAGTCAAAGAAAATTGATC
CCAATGGTCCACCAAAAGAGCCATTAAGGCGTGCACAGACGCCAGTCGCTTTCCTTCGTCCAGTTCAAGCGATTTTGACGTGTGAAAGCACAGTGGCAAT
TGTGCAAGTAATTCTGTGGAAGGTGATGTTCTCAGCTCATCCAGCGTCGGCGTCAACATCATCGAGTTCGGAGAACAACGTCTCAGACGCCGTTATCTCG
ACTTGTTTGCATTTGCTGGTGCATGGGGTTCACACAGCATCTCTAGCTCCAGATCGACGCTTCTGGGCGCGCTTGAGCAAGACGAATCCAGCCACCTCCA
AATTATCGGTACTAAATCTTTTGAGTCAATTGCTCGAGCAAGCGACAACCTTGCTCGACAGCGAGCAGACTGGAACGGTGGAATGGCTCATTTGGAAAAT
CACAATTGAATCACCTGCTTGCAGGAAGGTGTTTGAGCAGTTGGCAAATGACGCGAAGGCTAAACAAAAGAAGGCTGAGGCGTCACTTTCGGTAACCGGT
GGCTCTGCTCAAAGCAGCAATTCTTCACCAATGACATTGGAGCAGCGAAAACTGGAGGCTAGGAAGAGAGCGATGGCTGCAATGGCAAAACGCCAAGCCG
CTTTCCAGGCGATGGTAGACATGGCGGGTGAAGAAAATGAAGAAAAAAAGGATGAGTATGAGGAAGAGAATGACATGGGCTCGCTAGGCAAACGCAAGAC
TTCGATCGTGGAAGAACCTGTTGAGACCTCGAGCAAGCGCCAGAAGATGGAGAATGAGAAATGTTATAGCTGCATTCTCTGCCATGACAACTCGGCACAA
GGCCAGATGGGGATGGCAGCTTATGTCCATCAGTCCACTGTCTTAGCTCCCGGATTTAGACCTGAGCCTCACGAAGCGCTAGGCCCGGAGGGTAAGAAGG
TGCGCAATCATGTGAAGGAAGTGATTGAGAAGATGGAGTTGTGCTCAGGCGGCAGCTCGACGTCGTCTGACATGGCGAGCTCTCCGTCTCCCACTTTGCG
TGCTTTCTCAACTTCTTTTCCTGAATGGAGCATGGATGGCTCGCTGGACGACCAGCTAACTCGCGATAATACGGCGCAGAATAGCCCCCTCCCGCCGGCA
GCTCGTCGCCCTCGCAACGATCGCATACGCTTCGGAAATGGAAATATGCCGATGCTTGAAGGTGAGGTACTTCAGACGGATGAAGAGTTGGAGGTTCTTG
AGGGCGTTTTAGATCTCCGTGAGGACCAGCAATTATTTCCTATGGATATGCGTGGGGCTGTAAGTTTGGATTTACGCGGTGATCGTGTGGAGCCGCGTAG
ATTGGGAGGTCGTGAAATAGCTGGTGCGCGACTTGGCAACGCACGTGGACAAGGAGGGCCGATGTACGACAGTGATGATGATGGATACGAAGATGTCTCG
TCGCGTTTCCATCTGGAGCGTATGCCACCCGGGTTTGGTCGACCTCACGAAAGTGCTAAGCTTTATCTCACTCCGTGTGGCCTGCATATTCGCACGTGCC
AGCATGCGGTGCATATCCACTGTCTTGAGCGTTACATTACGTCACTACACGACAAGGCGATGCGTGGTGAAGAGTTTGATGGAGTTCAAGCCATAGACCC
GGATTCTGCGATGACGCAATTCCTGTGTCCATTGTGCAAGACTCTGAGCAATTTCTTGATCCCAACATCAGAACCTCGAATCTCGATTGCGAAGGGAGAC
GAAAGTGAGCATAAGCACTCTGTCGTGGCGCGAGGAGAAGAAGAAGAAAAATCTCCTACCTGGGACAAAATTGTTGAGGAGCAGATATCAATGCCAGGAT
GGTATCGCTCAGTGCTTGGGCGTGACGGAGGGTTTGAAGACGACGAGAACGATACCGAGCACGATTTGTGGCGGGATTACTTTGAGGAAACGCTGTGGGA
GCCCCATGGTAGCCTGGAGAAGGGTGCGCCTTTCTTGTGGTCTTCGTGTGCGTTTACCTTGGCATCTTTCTTGACTGTTGCGGAAGACGAATACCGCAAC
ATATCTGGAAGCAACGTCCCTTTTGATCCACTAACGGACCACTGCCCTCCCTCTCTAGAGAAGGAGATGGAATCGCTTACAGCTGTCACGAAGTTTTGCC
GATGGACATTTTCGCTATTGGAGCACAGTGCTGACGCCAAGGTGATCTGGGAGACTGCAAAGCGCTGCTGTCCGATTAACAATGAGACCAAACGAGAATA
CCGCAAGTTCACGAAGGTACTGCCGTTGCTTGACAGCGAGTTTATTTCGCTCTTTACGGCTGTGCTGGGTACTAATTTGTTCTTCTGTGTTTGTGTATAG
GTGCTTGGTTCAATTGATGCTTGCCTTCGCGGTACCATTTTGGGTCTACTAGTGGCAGACACATTTACGGTACGATATAGACTGTAGTACAGTTTGTGAT
CAAGCTCTTAAGTGTGCTGTGTACTTGCTGCAGGCTTTCGTCGTGGCAAGTGTTATCGCGGACGAGATCGAGACTATCTGGCGCTTTATCCCGGTGTTTA
CTGCTGCAGACCTGCTTCAACGTCTGCATGCTGAGTTTTTCGAGCCATGCAGGATTGAGGGGACATCGCTGTTTCAAGACAAATTTTCTGTTGTTGCAGC
AAGCGAGACAGAGTCGTCTGCTCAACCAACCGCAACTTCAGAGGCAAACGCTGCCGCTTTAGCCCCGCGCCGCACTAGAAGTGGTCGATCAATCAGCCCT
GCAGCGCCTGTTGCATCCACTGCTGGATCTGTACAGCAACTGATGCAAGCGATGGAAGCTTCTGGTGAGGAGGGATCCGATGAGTATGCTGTGCTACAAC
TGCTGCAGCGGATGGCGAAGACGTGTTCTTCTGAAAAGCTGAAGCCGCTCACAAGTGTAAGCGATGTGAGATCGCGATTGAAACGCATCTTGCCGGCAAA
TGCTGCGTTTGTTCGGCGTATGAAGCTTTTCTGGCGTTGTCTGACGGACGAGAATGCCGACGCGTCTGCAAACTCTAGGTCGATGCAAATTCCCACGTTG
GGTGATATTGCCCGCAGTAACGACCCCACGTTCGATCGAATCTGGCAATGGTGCATGGATCGTATGCTCAGCAAGACACATCTTGGCAGCTCAAAGGTTG
GGGACAAGTGCGAACATACTGAAGGTTGCAGCGAAGCGTACGTTGCTAGCATGTTCATCCTGCGCGAAGTGCCCATGCGACCGCGGCTTATTGATTTGCC
CATCCAATACGATGAGCTCTACAGCGAGATGGCAGATCGCAAGTGTACGCGATGTGACAAAGTTCCTTGCGACCCGGGCCTCTGTTTGATATGTGGCGAA
TACCTGTGCTGCGGCGATTCGTGCTGCACTCGTGCTTTCATGCCACACGGTCCACCTGTGGGCGAATGTACCCGTCATGCTGCTGAATGCGGAGGTGGCG
TGGGCATTGTACTTTTGCTAGAGCAGTGTCGCATTGCAGTTGTTGGCGGCAGCATGGCAGCGTACTTCCCATGCCCATACGTAGATGCACACGGCGAAGA
AGACGTCGGTCTCCAGCGGGGACGTCCGCTTCGACTCGACATGGCTCGCTACAAGTACCTGGAGTCACTGTGGCTCAGCCATCGTATCTTCACTGAGGTA
TCGCGGCAGCGCAACCAGCGCGACCCGCAGTATACGATCAACTTGTCGTATCTGTA