Transcript Name :
Phyra_g24
Orientation:
(-)
Number of Exons:
2
Description :
XP_009515389.1 hypothetical protein PHYSODRAFT_309032 [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
F-box domain8.941PS50181
Peptidase C19, ubiquitin-specific peptidase, DUSP domain10.918PS51283
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-416
*** None ***
PositionContextScore
184CVGRSRR|SI0.724
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
obsolete ubiquitin thiolesterase activityGO:0004221IEA
*** None ***
*** None ***
Sequence
        1334 bases(100 bases per row)
TGGAGCACCTACCGGAGGGTCTTCTAGCGCACCTCTTCTCGCTGCTATCGTCGCGCGATGTGCTCCAACTCACGTCTACCTGTCGCTCTCTGTCCGCCTC
ATCTGCGTGCGTGCAACTGGCCTTAGAGCGCGTCATCACGCGGCAGTTCGGCGACGTTACGGACTTCCTGCGGGCCTCCGTGGACCACTGGCCCCGCAGT
CTCACAGTGCTGCGCGGCGCTGAGCTGCTGCGTATCAAGGAGCTACTGGCGCGCTCGTCCACGCGGTCTTTCGAGGACGCGGCGCTGTGCGCGCCAAGCT
GCGTTGTCGTGAGCCGAGCATGGCTCGGCGCCTACAAGAAGCGCTGCCAGGCCTTCGAGCAGTTTTTGCTGCAGTTCCGCCACACAAAACGACAGCAGCG
GCGGCAAAATGCTGCTAAAAAGAAGGACAATTCCGAGCCGGAGAAGCTCAAAATTGCAGCTAATTCGTCGCTCGACGAGGCAGGAGCCATGATTGTCTGC
GCCCATGACGCCCTGCTGCCGGCGGCGCAGTGTGTGGGGCGCAGTCGACGCTCCATTATCAGCGGGGATGTGTTCAGGGAAATTGCTATCTATGCGCCGG
AGCTGAGGGGGTTTCCGCTGCGGTCGTGTTGCGACTGCATAACGTGTGTGTTGGAGCAGGAGGCGCGCGAGCTGGAGGCCGAGGAAAGGAAGAGGGCCAG
GTTTGACGGACAGATTGCAGGCTCGGAGGCCATGCTACAGCTTCTGGAGAGGAAGAACGGCTTCCCCAAGGGACTGTTCTCGCCGCAGGACTCGGTGGGC
AGACAGCAGCAGTTGGCGCCCCATTTGTCGGTCAACGGACGCAGCAAATACGCGACGTACTTTTTGGTGCCCAAGAAGTGGCTAAACAAGTGGCGCAAAT
ATGTTCGAAGTCAAGGGGATGATGCCCCCGGGCCGGTGTTGAACGCGGAGTTGGTGTGCTTGTCGCATCAGAGGACGATTGTGCCGCCCTACATCTCTAT
GTTCTTGTCGGGGTTCTCGCTGGAACAATCACTCAAGGCTACGCAAGCGTACGTACTTTGGTTGTGTGTCTTTGCTAGCTCGTAGTTGAGAATCATGCGC
CTGATTTGACTGTTTGGTTTTGGTATGTGTAGTCTCGGCACGACTCCCGCCCGCCAGTATGAGATCGTAACATTTGGCGAGTGGGAAGCTCTATACGATC
GATACTGTGCTGAATTTGCTGTAGGATTTGATGTCGTCAATGGGGCCTACCACTGGAGGACACAGGAGTGCCAGATCTGCAACTACGGCATGGGCGGCGG
ACCATCATCTAGTCAGCCCAACTCACGTCGCTGA