Transcript Name :
Phyra_g30
Orientation:
(-)
Number of Exons:
2
Description :
XP_009515398.1 hypothetical protein PHYSODRAFT_321807 [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-6
7-29
30-183
184-206
207-217
218-240
241-259
260-282
283-288
289-311
312-321
322-344
345-376
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1201 bases(100 bases per row)
TGCAGTCGCTCGAGCTGCTGCTGCTGAGTCTGGCGGCGCTGCTGTCCGTGGCCCGCGGCAGCATCTACGCGGGTTACACGGTCGGGCGGCAGTTCCAGTA
CATCGGCAAGTTCTGTTTCTCCTGGGCACCCACACTCGATGACGTCGCTGGAGTACGACCCAAGCCTAGATAACTTCGTAACCTACAAGCAATAGACTGA
CGCTGACGTCCCTGTTGTTGTAGCGCATCGCAGGTGAGATCGAGACGGACGTGACCGGGCTCCAAGTCGCCATCTACGACGACGAGGTGCTCTTCTGGAA
CTTCGTCATGACTGACAGCGACTGCGACTGCTACTGCAAAGTCTCTGCCAAGCACACCAAGGGCGTCTACAACGTCACTGCCACCACCAGTCATCACGTG
ACTCCGTTCTCCTTCAGTGTGGACATCCATGAACATCTACGCCCGAGGTTCTGGTACGTAGCGCTGGCGCGCTGCGTGCCCGGTGGGGACAAGTACAAAC
CTTCCTTCGCAGAAATCACGGAGACCAACTTCCGTAAATACTACTTCTCATCGTGGTATAATATCCACATGACGCAGGGGGATGGGAGTGAGCTCCCCGT
GCAGCAGCAAGGAATGCCCACGATCTACGCAGTCATGACCGCAGTGGCGGGAGCTGCAGCTGCGGCTCAAATGGTGGCTGTGCGGGGCATGAGGAGCGAG
TCGTTCCACCCGATTACGCGGATTCTCACGCTTGTGGTGCTCCTTTTCTTCCTGTGCAACGCACTGCTCTTTATCCATTTCACAACGTACCAGTTCAACG
GGTACGGAGTGCCGTTCTTTAAGTATGCGGCCAAGATCGCGGAGGTGTTCGTTCGCGTAGGCACGTTGCTACTGGCTATGCTGATTGCGAAAGGATGGAC
TATTAGTAGCGTCGCGCTGGACGGCCAGATCAAGCTCTCGTGTGTCATGCTCGCGATCCTCGCGTTGTATTTGTCCATGGCGATGTGGTATCTTATATGG
CTCGACCCCGCGTCGACGCTGTACATCTACGACTCATGGCCAGGTCTTGGCATCTGCGTTTTGCAGATGTGTGTGCTCGGGTGGTTTATCAACACCATCC
TGGAGACACGCTCGTACGAGAAGGCCTCAACAAAGCGGCGTTTCTTCCTGCGAGTAAGGATGACAAGTGCTATTGACTGCCCGACCAAAGTGCTGTACTA
A