Transcript Name :
Phyra_g8
Orientation:
(+)
Number of Exons:
1
Description :
XP_009515362.1 Avr4-associated TDF-like protein [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-356
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1070 bases(100 bases per row)
ATGAAGCTCTTCGCGCCTCTCGCCGCTGCCTACTGCGCACTCCTCGCATCCACCGCTGTCGCCGTCCAGGAAGAGACTAAAACCCTCGATGAGCTGTACG
CCGACGCCGTCGCTGAAGGAGGCAAGCTCGTCATGTACCACGGCGGAGACTTCGCGTCGCAGCAGGACTCGCTCCACGAGGCCTTCGCCGCCGCCTACCC
GGAAATCAACTTTACGCTCATCGTCGACTACAGCAAGTACCACGACGTGCGCATCGACAACCAACTGGAGACCGACACGCTCGTGCCAGACCTCGTGGCG
CTGCAGACGCTGCAGGACTTCCCGCGCTGGGCACAGGAGGGCAAGCTGCTCGAGTACAAGCCGGCCAACTTCTCGCAGGTCTACGACGGCTTCCGCGACC
AGCGCGGTGCCTACATGGCCTACATGATGTTCACCTTCAGCTTCCTGTACGATGAGGCTGCGCTGGGCGGCCTCGCAGCGCCCAAGTCTCCGGCCGACCT
CGTGGAGCCGCAGTGGGCCGGCAAGATCGCCTCGACCTACCCGAATGACGACGACGCCGTGCTCTTCTTGTACACGCGCTACGTGGAGAAGTACGGCTGG
AACTGGGTCGAGGACCTCGCCAACCAGAACGTCAGCTTCCACCGCGGCTCCAATACGGCCAGCGACCTCGTGACGGCCAAGGACAAGATCATCGGCGTCG
CCACGTACTGGGAGGGCACGCCCAACACGACGCTGGTGACGGACGGCGGCAACGAGTATCTGTCGTGGGGTCAGCGCATCGCCATCCTGAGCAAGGCCAA
GCACCCAGCGGCCGCCAAGCTCTTCATGAACTGGGCTATCTCGGAGGAGGTGCAGAAGACGGTCGTGGCCGAGAACGTGCGTGTGGACCTGACGCCCAAC
AGCGGCTCGAGCCACCCGTGGGAGATTTGCAAGGCAAATGTGGATGAGTTCCCGAAGTTCATGGCGGACCGCGAGGTGGTGGAGCAGTGGAAGCAGACGT
TCTCGCTGTACTTCGGAGAGGTGCAGGGCGAGCCGACTCCGGGCTTCCTTGGCGTGTACCCCGGTCTGTG