Transcript Name :
Phyra_g21
Orientation:
(+)
Number of Exons:
1
Description :
XP_009515383.1 pyruvate dehydrogenase E1 alpha subunit [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-399
NN-scoreoddsWeighted Score
0.6191.5120.003
*** None ***
TypeScore
mitochondrial91.3
GO
*** None ***
*** None ***
*** None ***
Sequence
        1199 bases(100 bases per row)
ATGATGATGCTCCGCCGCTCCACCGCCGCGCTGGCCCGCGCCGCCGCGCCCGCCTCGCGCGCCTTCAGCGCCGCCTCGGGCGAGGTCAAGTTCGACTTCG
CCCAGCCTTTCGAGCTGCACCGTCTCGAGGAAGGCCCCGCCGATTTCGCCGTGACGACCCGCGAGGAGATGCTGAGCTACTACAAGCTCATGTACACGAT
GCGCCGCATGGAGATCACGAACGACAACGAGTACAAGGCGCGTACCATCCGCGGCTTCTGCCACCTGTACGACGGTCAGGAGGCCGTGGCCACGGGCGTC
GAGGCCGCGCTCGAGCGCACGGACTCGTGGATCACGTCGTACCGTAACCACTGCATCATGCTCGCGCGTGGCGCCCAGGTCAAGGACGTGCTCGCCGAGC
TCTTCGGCAGGGGGGAAGGCGCCACGGGCGGCAAGGGTGGCTCCATGCACTTCTACAACAAGAAGGCCAACTTCTACGGCGGCCAGGGCATCGTCGGCGC
CCAAGTGCCTGTGGGCACGGGTCTGGGTTTTGCCAGCAAGTACAACCACAACGGCGAGGGCCTCATGCCCTGCGCCATCACCATGTTCGGCGACGGCGCG
TCCAACCAGGGTCAGGTGTTCGAGGCCTCCAACATGGCTGCGCTCTGGAAGCTGCCCGTGATTTTCTGCATTGAGAACAACCACTACGGCATGGGCACGT
CCTCCAAGCGCTCGTCGCACAACGACGAGTACTACACCATGGGCAACAAGATCCCCGGCATCAAGTGCGACGGCAACGACGTGCTCGCCGTGCGCGAGTG
CACCAAGTTCCTCAAGCAGTGGTGCGGCGAGGGCAAGGGCCCCATCTTCGTCGAGATGAACACGTATCGCTACCACGGCCACTCCATGTCGGACCCCGGC
GTGACGTACCGTAACCGTGACGAGATCTCGCAGATGCGTGCGTCGCGCGACCCCATTGAGCTCGTTAAGAAGCGCATGATCGAGTCGGAGCTCGCGACTG
CCGACGAGATCAAGGACCTGGAGAAGAAGGTGCGCGCCGAGGTCGTCAAGGCCACCAAGGAGGCCAAGGCCTCGAGCAAGCCCGAGGAGTCGGAGGCTTT
CGAGGGTGTGTACGCGGACGACAAGGGCAACAACGTGTACCCGCCCTTCATCCGTTTCCCCGACTACGCCAAGAGCCTGTACAACGGCAAGCGCCAGTA