Transcript Name :
Phyra_g11
Orientation:
(-)
Number of Exons:
2
Description :
XP_009515367.1 hypothetical protein PHYSODRAFT_472216 [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Bin3-type S-adenosyl-L-methionine binding domain50.813PS51515
Double-stranded RNA-binding domain17.622PS50137
HmmSmart predictionP-Valprediction_id
Double-stranded RNA-binding domain0.00000000000021SM00358
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Double-stranded RNA-binding domainIPR014720
*** None ***
InsideOutsideTMhelix
1-371
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
methyltransferase activityGO:0008168IEA
*** None ***
*** None ***
Sequence
        1206 bases(100 bases per row)
TGGCGTCCAACGACGCCGAAGGGCACGTGCTGGGCAACTTCCACGCGTATTACAGCTTCAACCCGGTGCACGAGCGCTTGCGGTTTATGGACGTGCAGAC
TGCCAATGCCTTGAGACGCGCGCTGCTTGTGCGTAAATCCGCTGAAGAGACGTCTACGGTCGTCGACATCGGCTGCAACGAAGGCGACTTGACCATTGGA
CTCTACGACGCGTTGAACGGACGCGCAAGACTGGCAGACGCCAAGCAGATCGACGATGTAGCCAGCTTTGACCTCATGAACATCAGCACGCTCAACGAGC
GCATGCAGAAAGACAAGAAGCAGGTGGAATACGTGATCCAGGACAAGGGTGAGACCAGCCACCGCAGACGCTATGTGGTCGAGCTGCTGGTTGACGGGAA
GGCAATGGGCCACGGTGAAGGCGTGTCGAAGAAGGTTGCCAAGGCAAAGGCAGCTGAAGTTGCTCTGCAAGTTCTGGACGGATCGGATAGCCAAAAGACA
CAGGAGAAGGAGTCGAAGGACGAAAAGGTTGTCCCGGAGCAGCTACCGTTGACGGAACAAGAGCTGGCAACGAGGAAGTCGCTGATGGTTCTGGGTGTGG
ACATTGACAAGGTGCTGATTGAGCGTGCTACCAAGAAGTCCGTGCAGCTGACTGTCGACGACCAGGTGCAGTTCCGCCATGTTGATGTCATGACGAGCAA
GTTTAACGAGGACATCGCTCCGTTCTTGGAGCTGGCGAAGCGCTCAACGGCGGAAAGGAAGTTTGATCTCGTCACTTGCTTCAGTGTGACCATGTGGATT
CATCTGAACAACGGAGATGAAGGACTCTGGACGTTCCTAGAGACGGTCAGTGACATGACAGAGCACCTGATCATCGAGCCGCAGACCTGGAAGTGCTATC
GGTAGGTTGTCTGCGTTGTGGTTATCCTATTGAGGTCCCACTGAGCTAGTGTACCAATCATTTGTTGCTTTGTTATTGATTGTCATCACCAGCAATGCAC
AAAAGCGACTGAACCGCATGCACGTCGAGGTGCCCCAATCCTTCCGCGAGATCAAGGTGCGCACGGATGTCGTGGAGAAGATTGATGCGTTTCTTCTGTC
CGCTGGCCGTTTCCGCTTCAAGGCACAACTGGGCAAGACCAACTGGTCGCGGAACGTAGTTCTCTACAGCCGCAAGCCCGTGGAAGGGATCACTTACGCC
TCATGA