Transcript Name :
Phyra_g12
Orientation:
(+)
Number of Exons:
10
Description :
KUF69652.1 Sodium/hydrogen exchanger [Phytophthora nicotianae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Na+/H+ exchanger0.0000000000031PR01084
Na+/H+ exchanger0.0000000000031PR01084
Na+/H+ exchanger0.0000000000031PR01084
Na+/H+ exchanger0.0000000000031PR01084
Profile scan predictionP-Valprediction_id
Surfeit locus 1/Shy124.363PS50895
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-38
39-61
62-267
268-285
286-306
307-324
325-330
331-353
354-367
368-385
386-397
398-420
421-429
430-452
453-458
459-481
482-503
504-526
527-532
533-555
556-560
561-583
584-595
596-618
619-637
638-660
661-672
673-692
693-711
712-734
735-877
*** None ***
PositionContextScore
587VLSREAR|HA0.556
*** None ***
GO
Biological ProcessGO IDPrediction Method
sodium:proton antiporter activityGO:0015385IEA
membraneGO:0016020IEA
integral component of membraneGO:0016021IEA
sodium ion transportGO:0006814IEA
regulation of pHGO:0006885IEA
*** None ***
*** None ***
Sequence
        3370 bases(100 bases per row)
ATGCTGGGGTGTCGGGTGCTACGCGCGGTGCCGCGTCTGTCAACGAGCTCCAAGCGCTTCGCGGCGTCTGCGGCACAGGCGAAGACCGGAGGATCCAGCA
GCGACGAGAGCAACTTTTCCAGATACGCTGGCATGGCATTCTTTGGCGCTGTGGTGCGTTCGAGAGAGGAATAGACAAGAGGAGGGGTAGAGCTGAATGG
TCTGCTTTGTGGTGTGGATTGCAGGCGGTGACGACGGCGTATCTCGGCACGTGGCAGGTGTGAAGAGTATTTGATTTGGGTGATGGTCGGAGGTTCATCG
CTAATGTGCTGGATGCAGACAGAGCGCTACTACTGGAAGGTGGATCTGATCAACGAACGCACGAAGGAGCTGTCCGAGTCGGTTGCAGATCTGCCCAAAG
AAGCGACGGCCAGCGATGACATGTGGGTGATGCGTGGGCTGGTTGTGTTATTTAAACTGAGGTGGACGCGCTCACCGTGTTGGATACGTTTCGACAAAGT
GATGACATTGAGTACCGCCAGCTTCGCCTCAAGGGCAAATTCAAGCCTGGAAGCACCTTCTACCTGTGTACGAAACTTGTTTTGAACAAATGGCCACTGG
TGGTGCATATACCTGACTTTTGGGTGTGTGGTGGTTTTTAATGCTAGACCCTCGCTCTGCTCCTGCTGAGTCTAGCGATTCGGTGGCAAGAGTGAAGTCC
GGCGGCTACATTTATTCTCTACTGGAGCGTGAGAACGGGTATGAGCTGTATGTCCCGTAGTCTATGTAAAGTTGAAGCTCACCAGTTTCTGTAGAACGCC
GGTTATTGTGAACCGAGGTTGGCTTCCGCGCAAGCTCTTGGATGAACACATGGCACGCGACAAAAAGGAGGAAGATGGCGAAGTGACTTTCGTTGGAGTA
CTTCGTCATGGAGAAGTGGTGCGTATTAGTGTGGGATTCGTTTGGCTTGGTACACTGTTGACACTTCTGCTGTGTGTGCTTGCAGAAAAACAACTTTACG
CCAGACAATGACCTGGAGAATCGCCAATTCTTTTACTTAGCCCACGAAGAGCTGACTGATGCCATGGGGGTCACCTCTGCCGATCTACCTGTCATCGTTG
ATGCGCTTGGTACATGGTCTAAGCCTTTCTTGCCTTTTTGTCGGCAGCTTGTACTAATGATCTGCTTGTGCTGTTGCAGCAATTGAGGGCGACAGTGGCG
AAGTGACACTGGACAACCCCGTCCGAAAGAGCATCGCGTCTTACTTAGAGTTCTACATGACCCCTGAGAAGCATGCTGGTTATGCGGCGACCTGGTAAGG
AGAGCCTACTACTGATTGAGATGGCAAGCGGGCGACTAACGGCATCATACGTGCAGGTTTGGTTGCAGCATTGCGGCTGCTGTCATGGGCGTCCTGCGCT
TCAAGAAGGGAGGTGTCCGCGCTCTCCGTGCTCCGAGGTTCGAGCACCGCTAAGCATAGTAAGCTTAGGTGCAGTAAGATAGTCGCCATCTTCGTCTACA
ACTCGCTCCTAAGAAATACTGCTAAAACAGCTGCTTTTAGCCAGTAGGTTTGACGATTTGTCGGTAAAAACGAGCTCCGGCTTCCTGGCAGCAATTCGCG
ATGATAAGCCGATATGAAGCACGGAAGAGAAGTCGAGGAGGGGGCGATGGAGGACGCGGTGGTGCTGCTGCTCATGCTGTTCGTGCTGGTAGTGGTGTCC
TTCGTGCTGGACCGGTACTCGTGTAACTTGGTGTCGCAGAGCGGCTTCGCGATGGTGTTCGGCCTCGTAGTGGGGCTCTTCATGATCATGGGGGACAAGC
ACGCGGCGCTGCACACGCACCTGAACCTGGACAACAGTCTCTTCTTCAATGTGTTGCTACCCCCGATCATCTACGAAGGAGGTTTCTCCATCAAGCGTCA
AGCTTTCTTCCGCAACTTCCCGGCCATCATGAGCACGGCTGTCGTTGGCACAGTCGTGGCGGCAACCATCACGGGTGGCGTGCTGTACCTCGCTGGGGCG
TCCAAGATGGTGACGAGGCTCTCGTGGGTGGAGGCTCTGCTGTTTGGCACGTTGATTAATGCTGTGGATCCGGTCGCTACGTTGGCGTGCTTCAATAGGC
TGCACGTCCCGCCGCTGCTGTTCAACCTCGTGTTTGGAGAGAGTGTGATCAACAATGCAGTGGCGATCGCGCTGTATCAGACGCTGCACAAATGGGATGC
AGACATTGACTTGAGTGTCAAGCAGTTGCTACGGGTGGCTATCAACACTGGAGGCATGTTTGTGGGGTCGCTGTTGGTGAGTGCGGTGATTACTCTGTGT
GGCGCCTTTTTGCTCAAGCGCAAGGTTTTCTCGTCGCTGCACTACTTCCCCAGCTACGAGATTTGTTTGTGCCTGATCTTTAGCCTGCTGACGTATTTTG
TGGCGGATAGCTTCAAGCTGAGTGGCATCGTTTCGCTGTTCTTCTCGGGCACCATGACGGCGCACTACCACTTTAATGTGCTGTCGCGCGAGGCTCGACA
CGCCTTCACGCACTTGTTGCACACAGTCTCTTTCGTATGTGAGAACGTCGTGTATGTGTTCATGGGAACTTCGGTGATCATGATCTTCTCCGGTCATCCA
GAGAAAAACTCCGGCGCTGCACTTCGCGTGGACGACATCGATTGGCATTTCATCGGGCTCACGCTCGTGGCCTGCTTCGTGGCGCGGGTTTTAAACATTT
TCCCACTGCTCTGGCTCGCCAACTGCTCGCGAGAGTCCTCCGACCGCATTCCGATCAAGTACATGAGTGTAATGTGGTTCGTCGCTCTCCGCGGATCCAT
TGCATTCGCGCTCGCCAAGAACTGGAACTACGTCGGCCTTCACGGTGCGTCACACCGCCAACTCGTCGAATCAACCACGCTCGTCGTGGTGCTCTTTACA
ACGATCGTGATCGGCGGATTGACGGGCCCACTTCTGTCTAAGCTGCGGCTCACTGGCCACCACAGTGCACTGAGGCAATCTGAATCTGCGTCCGACGAGG
ATCGCGCTCTGGAGCTGCAGCGCAGCACTCGTCACTTCATGCTGCGTCGGGACTCCAGAGCTACGGAGCCGCAAGCGTCTGCACAGAGAGCTGCAGGCGA
GCAAGAGACCGAGGTGGACGATGCACCCATATTCACATCGCGGCCGCAGTTCCGAGACGACGACTACAGCGACGACGAGGGTGAACGCAACCCAGACTCG
CCTCAACAGCGCGGCGAGACGCTGACGCGCGCGTTCTTTCGCAACTGGCAGGCCTTCGACGCTGCGTACATGCAACCTATCTTCGGCGGTTATGTCCAGC
CGTCACCGAGGCCCGCGAACGAACCCCGAGACGAGCAACTCGGTAAGACGCAGACCCAGGACGCCGTCTG