Transcript Name :
Phyra_g23
Orientation:
(+)
Number of Exons:
6
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-77
78-100
101-178
179-201
202-278
279-301
302-312
313-335
336-493
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2591 bases(100 bases per row)
ATGTTGTTTGGCGTTGATGTGAGTCCACCACCAAGAACGTTCCCAGTTAGCCCAAGCAAGTTCAAGATTTTCATCGGGTTCTTCCAGATTTTCGGCAACT
TTCAAAGCTCCTTCGTCGTGAAGTGGTCGTCTGGCATTCAAAATGTCATGGATTTCTCACAGAAGTTCAATCTGGTACGTTTGGAACTGGTTCGAGTTGA
AGTGCTTGCTGAACTAACTGAAATACTTCAATTAGGACCTGGTTGCTATCGCCGGTATCGACTGCGTGGTCACAAAAAACTTTTACTTCGACTTCACGTG
AGTGTTTGTTGTTGCTTTATCGTGCTCTTGTTTCATTTTTCTGACTTGATCATGTGCTTGTCTGGCTGATTTTGGGCTAGTGTCACTGTGACCCTCGTTG
TGTTTGCCCTCATGATTATTACCGCGTACTTCTACGCTGGTATGCGCAGCTATCGTGCAAAACTACAACTTATTCCGCGCAATTGTTTGCGATGTGGACT
CCCGGTGCTTGAAAGTGAAACTATTCGAAATGACGACGAAAGTTTTAACCCATTTCTGCTACTAAGAAGCTGGTGGCAGACCCATAACTTCTACAAGAAT
GACTCGCTGGCGCCAAATGTGGTGGAGGCAACAGAAGTTCCCCAAAACGAAAGCTCTGTCGCGGTGTCAACTCTTAAAGAGACTCGGTCACTGAAGCGCA
AGTTCGGGATGTCTCAAGTGCGAACCCCCTACCTAGGCTTGTTCCGCTCAACTCATTCCAGGTGTCCTGTGAAAAGCCATGTCCTCTCTGGTGCGATTCT
TGATCGTACAGTTCGTAGTAATCTACGGGTGTGGCAAGCGCGAGTCAAGTTGCGTATGAACTATCTGACGTACCGTAACAAGTGCCTGAAACTCTACTGC
TGGATGGCTCTCTTCCTGTATCCGTCGGTGTCCAAGACAATATTGACCGTCTACAATTGCCAAGAGGTTGGAGACGTCTTTTATCTGGTGGCAGATCGTC
GCCTCGTGTGCTACCATGGGCAATGGGCTCTGTTTGGCGTGATCGCGACAATCGGTGTTGTGGTGTGGGTCGTCGGAATTCCATTCTTCTTCGGTGTACT
CATCTGGTTAGCACAGGATCGTGGTGTAGCTGCACGTCTGAAGTTGCTGCGCAAACCACACATGCGCGCTCAACTGCACAAGTGGCTCAAAGAAGTGGAG
GAGCAGCAAGTCGCAGATGGGCGCTTTGTTCGCCACATGGATAGTCTTGAAGTGCAGGACGAGGAGCTGGCAAAGTACATGAAGTGCAAAAATTTGACGG
TACGGAGGCTCATGTCCTTGCATATGAACTAGAGTGAATACTTGCTTACCCCCGCGTTTGTATACAGGACTCCACTGTGCAAGCGCGACTCGGATTTATT
TACGCTGAATGTAAGTGATGTTGCAGAAATTGCTGCCTTAGACTTGCTCTTGACAGTTGTACCTGCAGATTCAAACGATTACTGGTGGTTCGAAGTTGTG
GACCTTTCCCGAAAACTTTTCTTGAGTGGGGTAATTATATTCGTGGAAAATGGAAGTGTCGAGCAAGTGCTACTTGCGCTTTGTGTTTGGTAAGACTTAG
TTGGTGCATTTTGTCATGGAATCTTTGGTCATAATTTTCTAACGAGCAAATGCTTGGTGTATTTGTGTGTCGTGCCCAGTCTGATGACGATGTGGTTCCT
GCTATATTTCCAGCCCTATGACGGATATTCGGACAACCTCATCGCAAGCATCACTCAGTTACAGCTCTTTTTCACGTTGTGGCTTGGTGTCATGATCCGA
CTGAACGGTCTCAATACTGAGTCACTGATCAACGTTCAGCTATTGAGTTTTGTGCTAGTCGGCACGTGCATCGCTGTTACAATCTTTGGACTGAGTATGA
TTGTGGCTGAAGGCCTCTCGGAGTCACAGCGGATATTCACGGAAACGAAGGCGCAGCGTAAGAAACAAGTTCAAGATGAAGTGAGGAAATGTTGGTTCAA
GGCGTACAATTACGCAGCTTACGAAGCTCAAATGGTGCGATATGGAGGGCAGCTGAGCCTTAGTAAGTTCAGTGTACCTGCTATGCTTGAAGTCTTCCGC
AGAGCGAAGCTGGCAGGTGAAGATCCTGAGTATGCCGGCGTGATGCCCAAAATGGAAGAAGAAAGCATTGAGCGCTCACCAATCGGTAAACGTCAGCCAG
AGTACGTGCTTGAAAACAATGCAGACGATGCAAACCAACACGGGGATGCCAAAGAGGAGGACTTGCCAAAGAATGACTGCCAGGCACAACACGCAGACCA
TTCAGCTGGACCAGACCGAATCGAGGGCGTCGACGTAGAGAACAAGCTGCCGACACATCGTGCGTCTGATTATGTTAACGACAACGATGTAGCAACTATT
CCTCAAGAACCAAACGAAACGAGGTAGATGGGGTTAGGAATGTAAACGTTTGTCAACTGTTGGAGCGTCATCTTGACGAAGAGGATGCTGTTGCTGGTAG
CTTTGAGCCTTTGGCGGAGGACGATGTTGACGAAAATTCTGCTTCAAATTCGGGTGTTGCTCGACCACAGCGAGGACACGAGCAATCCGTA