Transcript Name :
Phyra_g7330
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site7.858PS50096
Ankyrin repeat-containing domain10.445PS50297
Pleckstrin homology domain11.281PS50003
Ankyrin repeat-containing domain14.875PS50297
Ankyrin repeat9.644PS50088
HmmSmart predictionP-Valprediction_id
Myosin head, motor domain0SM00242
IQ motif, EF-hand binding site300SM00015
IQ motif, EF-hand binding site31SM00015
IQ motif, EF-hand binding site6.5SM00015
IQ motif, EF-hand binding site0.48SM00015
Ankyrin repeat27SM00248
Ankyrin repeat0.34SM00248
Pleckstrin homology domain0.0000000045SM00233
Ankyrin repeat690SM00248
Ankyrin repeat4SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pleckstrin homology domainIPR001849
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-1689
*** None ***
PositionContextScore
1551LGSRRPR|IV0.585
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
*** None ***
Sequence
        5750 bases(100 bases per row)
ATGCTCGCGCGACGAACGCCCCCGACGATCTCTACTCGCCCACCGAGCTCCAAGACGCTCGGAAAGGGCGTCGACAGCCCCAGCAGCAGCAACCAGCAGC
AGAGCAACAACGCCAACCATGCAGGACGCCCCGTGCTCGGACAGATCGACGCCAAGCACCTGCAGATCGGCGCCAAAGTGTGGGTGGCAGACGCCAAAGT
GCTCTGGCGCATCGGCGAGGTGCAAACCATCGCCGAAGACAGGCGGACAGCGCAGGTGTACCTTCCCGATGCAGCGGACGAGCAGGTGCAAACCCTGCGA
ATGGACCAGCTCTTTACCTTCGACGCCTCGCACATCGTCGACCACACCGACGTGGCGCTCATGAACAACATGCACGAGGCGCCGCTGCTCAATGTGCTGC
GCCAGCGCTTCGAGCGGGACCAGATCTACACGTTCACAGCAGACATTTTGCTCTCGATCAACCCGTACAAATCTATTCCGCTGCTGTATGACGTCGTCGG
CTTCATGAACAACCGTCAGGAAGCTGCTACGGCCACTGGAGACGGCTCAAACAGCGACAGCAGTGCGCCGCCACATTTGTTTTCGATCGCGGAGAAGGCG
TACACAGGCATGAAAGGCGTCGTCCCGGGCTCTGGCGCTCCACAGTCGATTGTCATCAGCGGAGAAAGCGGTGCCGGCAAGACGGAGGCTTCCAAGTACA
TCATGAAGTACCTCGCCACAGCGAGCAAGCACGTCGCCAGCACTAGTACCGGAAAGGCGGCAGCTGCTGCTGCAGGTGTTCACGAGCAGATCGAGGAGTG
CGTCGTGCTCTCCAACTTAATCCTCGAGTCGTTCGGCAACGCCAAGACTTCGCGCAATGACAACTCGAGTCGTTTCGGCAAGTATATCCAGATCCACTAC
AGCAGCGAAGGCCGCATGGCCGGGGTCTCGATCCGCCACTTTCTGCTGGAGAAGACGAGACTCGTACGCCCGGAAGCTAACGAGCGCAACTACCACATCT
TCTACCAGTTGCTAGCGGGGCTTGATTCATTGACGAATACAACGTCAGACCCTGCAGACTCCGATCGGCCACTACTGCTGCGGAACGACGTGTGGAACTA
CACGTACCTCACCCGTGGAGATTGTGTCGAGGTGGACGGAGTGGACGATGCCACCGAGTTTGATCAGCTCCGACGGTGTCTGGAGCAGCTTGGAATGGAC
AGCGCCAGTTTCCAGCGCCCTATGTTCGAGCTTCTGGCAGCCATTCTTCACCTCGGCAACGTGCAATTCGAAAGCTCGACAACACAAGATAACAGCAATG
GAGATGATCGTCGAGAGGACGAGCCAACCAGAGTTGTGTTCCCAGAATGTGATGCTGGTGTGAACCTTGAGCATGTAGCGATGCTGCTGGGTGTCGACGC
TACGGAGTTCGCCAACAAGATGGTAACACAAACCACCGTTACCGGTCGCGGCAGTATTCTGGAGATCAAGCTCACCCCTGAGCAGGCCAAGAATGCCATG
GATGCTTTCTGCAAATATCTGTACGGCGAGCTTTTCCACCATGTGATCGCGCGTATCAATGCCTGTGCCAAACAGCAGACATCCCTTATCCCTCCTACAG
CCGGTGCCGACAAAAAGACGCCAAAGTCGCGCGGCGCAACGGCGCCATCCGTGGCTCCGTTCATCGGAATTCTCGATATCTTCGGGTTCGAGGTGATGAA
GCGCAACAGCCTCGAGCAGTTGTGCATCAATTTCACAAATGAAACACTGCAGCAGCAGTTCAACAAGCACGTGTTTGTGCTGGAGCAGGAGCGATACGCT
CGCGAGGGCATCGCAGTGTCCCCTGTGGAATTTCAGGACAACCAGCGATGTCTCGACTTGATCCAGAAACCGCCGCTCGGATTGTTGCCACTACTCGAGG
AGCAGATGCTGCTCAAGCGCAAGACCACGGATAAGCAACTGCTCACGATCTACCACGGAAACCACCTCGAGAAGCACTCGAGCTACGCCAAGCCGCGCTT
CGAGTGCGACGAGTTCATCATTCGCCACTACGCAGGGGATGTCATCTATGACATCCACGACTTCATCGCCAAAAACACCGACAATCTGCACGAAGACTTG
CTGGACCTGCTGCGTCGTAGCTCGCAGCCGCTTCTGCAAACCATGTTTAACGTCCCCGCTGCGGCGGCAATCGGTGGCGCGGCAACAAAACGTGGAGGGC
CAACGACGCCAATTGGAGCAATGCACAGGCGCACACAGAGTGCATCGCTCACTGGCACGACTACCGTATCGAGTCGCTTCCGCACGCAGCTGGCTGAGCT
CATGGAGGTTCTGTGGAGCACGTCTCCCAGCTACATCAAATGCATCAAGCCAAACAACCTGAAGTTTCCGGGTGGTTTCAGCTGTGAACTCGTGCGCGAC
CAGCTCGTGTACAGCGGTGTGCTGGAGGTTGTACGAATTCGCCAGGAGGGGTTCCCAATCCGCAAACAGTTCAACGTCTTCTACGAGCTCTTTTGGCCAC
TGGCGACCGCAAAGTATGGCGTAGCAGCTACGAGAGGCAATTCCAGCAAAACTCGTGAGGCTTGTGAAGCAATCGCCCGTGAGTGGCTCAAGGATAAGGA
ACTCGAACGAGAAAGTGACCCGACAAAGGAAGACGACGAATCGCCTGAGGTTGAGAAGGATGAGGCTGATGCAAAGCCCACTCGACCACCAGCTCGACAA
ATTTTTGCCATGGGCAAGAACGAGATTTTCCTGCGTTACGGTCAGGTTGAGCGGCTCGAGGCGTCATTGGCCACACTTCGACTAGAGAGCATTGTGATTC
TGCAGTCCAAGCTGGTGCGTTCCCGACTAGCCTTCAAGAAATTCCACTTGCTGCGTCGAGCGACGTTACACTGGCAAGCGCTGTGGCGGATGCGAGTACA
ACGTGTGAAGTTTTTGAAACAGCGGAGAGCTGCCATCCAGATTCAAGCCCGCTTCCGTGGCTTCCGATTGCACGCACTGTTCCACAAGAAGAAGCGTGCT
GCTATCGTTCTGACACGCGCGTCACGGCGATATGTTACGCGCTGCAAGTTCCTGCGCTTTGTCAAGTCCACGCGGGCCGCAACTGAGATTCAGCGTCATG
TTCGAGGATTCATGTTGCGCACTGCAGCTGAGCGAGAGCGAAAGATGCGCGCTCGCGCTACACTCAGGCTGCAGTCGTGGCAGCGCATGCATGTGCATCG
TCGAACTTTCTTGATCCAGCGACGAGCAGCAGTTCGTGTCCAAACGAAGTACCGGGCTCGTACCCAGCGTCGTCGATTCCTGAGCGAGAAGAAGGCAGCA
ATCGTATTGGCAGCATTTACACGCCAGGTTTTGCAGCGAAGGCGCTTTAGAAAGCTCAAAGCCTGCATCGTGAAAACACAAGCGATGGTTCGCAAGTGGG
AAGCCCGGAGTCGCTTTGTCGCGCTACGTAGAGCTCTCGTCTGCGTCCAGAGTCTACGCCGTCAGCGTACCGCACGACAGATATTTAACGTCCGAAAAGC
TGCGGTGGCTTGCCTTCAGCACGCTGTGATCGGCTGGATCGCGAGGTGCCGCTACGTCTCGCTGAAGCAAAGTACTCGAACGCTTCAGTACTGTGTAACG
AGCTGGTTGCTTTGCCGGCGATTCCGGCGTGTTCGTACCGCGTCAAGACGCATTCAGAAGTCGTGGCGGTCGCATCATCGGCGAGTTCGTTGGGAAGCAG
AGGTTGCTAGCGTCTTTGCATATCGAGGATCAAATGCCGCAGCACCAGGCAGCGGTATCACTTCTTCGTCCTGGACACAGCACACACGCATGGAGGAATC
GGACCGACGAATGGCCAAGCTGCGGAGCTACCCGGATATTTTCTTTACGTTGCAGCCACGAACCTTCGGCTACAACTCGCTGTTCCACGAAGCGGCAGCA
TGCGGTGATTTCCATGTCGTAAAGTACATGCTCACTGAGCGCTCCAACGAAGAGTTACTTGGACTCAAGAACGGCCGCGGATTTACCGCGCTCCACGAGG
CGTGCACCTACGGCCAGCATGCAATGGTGAAATTCCTTGCGCTACAGACAACAGAATTGACAGCCACACGAGCTCGTAATCCCATCTCGTCAACCCGTAA
AGCACCAGAGCAAACTGTCAAAACGAGCTCTACTGAGGGACCGGAGCAGGTGGATGCCAATACAGCGATACTATCGGATCATACTGGGAACCAGCAAGAA
GACGGGGAGCCTGAAACCACAGAGGTGGAGCGAACTGTGGTCTTCAGTGGCTTTCTCCGCAAGCGGCGAGAAACTTCCCGCTGGATGCGTCGATACGTGG
TGCTCAGTGTAGCTGCGGATAAGCACGATCGTCCACAGCTAGATTACTACCTGAGCGACCGCAAGGCCACGCTGGCTGGACCCAGTTCTCGTCAGATCGA
CTTGACCAATGCTCTGCTGAAGACAAGCGTGGATTTGCCTTTCGCCTTCGAGCTGCACTCTCCACAACTGCTGTGTGGGCGCAACAAGGAGGGTCGGTTG
TACTTCGCGGCATCGGGTGCTCTTGAAATTCAGTGCTGGCTCGCACATTTGCGCAACAGCATCCCAAGCAGCATCGAGTCGCGCGTGTTTGCCATGCACC
GGTCCGCCCAGAATAACAAGCTTGAGTTTGTAGACTTTCAGACCCGCCAGGAGGCCTGCAATCTGCAAAGTACGTCGCCGCGACAGGAGACGCCACTGCA
CTTGGTCGCAAGTTGCAACAGTCTCGTGATTTTAGCGACGATTGAAGATGATGATCGCGGCAACAACACGAACAATACCAACAGTGAGATACAGCTGGAT
GTTACCGTCGTCGCAGCCTCTTCTAAGTCCAAGTCACTCCTGGATGCTGAGCTGGAGCTAGTGAAGACGACGCAGTGGCTGCTGGAGAATGGAGCCGATA
TCAACGCGATGACAACACGGCAGGAAACACCACTGCAGTTGGCGCTGCAAGCCGGTCACTTGGTACTGGCAAAGCTGCTGCTGGACCGCGGGGCACTAGC
GTCAGGGCTTTCTGAGCCGCATTTGATTCTGGTACGCTGCTTGAAGGCTGAGTTGGCGAAGACTGCTATCACAAGTATCTCTTCAGCTGCATGCGCATCC
GTAGGGATCTCACACGCTCCTCAGCCACCTAGTGGCACGGCAAATTCGCTGTTGGCAGCCCTACTGAAGCGACCCAACAAGCTAACACGGCGCTTGAGTG
CAAGTGAGGAAGAGCTACCGTTGCTTTTCTTGATCAAGCAGCCGGGTAAAGTGCGCCACAGCTCGTACGTGTCGCTTTTCGTCGAGCTCATCGGACTGAA
CGATGCGGCATCACTGGGTAGTCGAAGGCCGCGCATCGTCATCTCCGTAATGGACGGACAGCGCAATCTCGTCGAGATGAGGCAGCAAGTATCCGTACAG
CCTGTGGCAGCCTCCAACGCGCTCCTCTGGGGCTTCACGTGGCACATGCAGACGCCGTTAGAGAACTTGCCACACGCAGCCTGCGTCGTAATCGAGCTTG
CCAGTACCAGCACTTCGTCCGTCTCGCCAACGAATGACGGTGTTACGTCTCCAACTCTTGGTGCCAGCGTGTTAGTCCCCGAGTGCTGGACGTACCTGCA
AGTCGACCAGCGCACGGCCAACAGCGCGCCTCTCACCGCTGAAATGTACAAGTACCCAGTAGATCTGTCGTCGCGAAACACTCTGCACCGCGCCGACGCG
TTCCTCTCCGGCGAGATGCTGATCTCCCAAGCGCAGACGTACGACACGTA