Transcript Name :
Phyra_g9942
Orientation:
(+)
Number of Exons:
1
Description :
XP_008894180.1 queuine tRNA-ribosyltransferase [Phytophthora parasitica INRA-310
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-407
NN-scoreoddsWeighted Score
0.6461.9660.004
*** None ***
TypeScore
cytoplasmic56.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        1223 bases(100 bases per row)
ATGAAGATGCCGAGCGCTTTGACCTTCGAGGTGCTGGCGAAACACCATCGAGCGCGCGCTGCGACGCTCACGTTGCCCCATGGACAAGTCCGCACGCCGG
TGTTTATGCCCGTGGGGACGCAAGGCGCCATCAAGGGACTGACCACCGCACAGATGCAGGACGTGGACTGCCAGATCTTCCTGGCCAATACCTACCACTT
AGCGCTGCGTCCGGGCACGGACGTGTTGGCGCAATTGCCCGGCAAACTGCACGAGTTTATGCAGTGGCCCCGCAACCTGCTGACCGACTCGGGGGGGTTC
CAGATGGTGAGTCTCTCGAAACTCTGTGAGGTGTCGGAGCACGGCGTGCAGTTCGAGAGCTTCGTGGACGGCTCCACGATGGTGTTGACCCCGGAGGCGT
CGATCGCCCACCAGAACCGCATTGGAGCGGATATCATCATGGCGCTGGACGATGTCGTCTCGAGCTTGGCCGATGACGACGAACGGTTTAAGGAGGCGTG
TGGACGCACGGTGCGGTGGCTGGACCGCTGCATCGAAGCGCATGCCCACCCGGACAAGCAGAATCTCTTTGGTATTGTGCAGGGTGGACTGGATGTGAGT
GAAGGGGGGCTACGAGACCAATGTCTGAGTGAACTCATCAAGCGCGACCTGCCTGGATATGCGATCGGCGGATTGGCCGGAGGTGAATCCAAGGAGGCGT
TCTGGAAAGTGGTGGCGCGCTGCACGGCTCAACTGCCGGAGAACAAGCCTCGGTATTTGATGGGGGTTGGCTACCCGCTGGATCTCGTCGTGTGCTCTGC
TCTGGGCGTGGATATGTTTGACTGCGTGTACCCGACTCGCACGGCGCGGTTTGGCACGGCTATTGTGCCGTCGGGGCTTTTGAAGCTGAAGAGCGCCAAG
TGCGAGGAGGACGAACGACCCATTGACGACACGTGCGAGTGCTTTGTGTGCAAGAAATACACACGTGCATACTTGCGAGTGCTGTTGAAGAAAGAGGAGA
CTTTCGGTGATGCAGAGGAGACGACGGGGAGCATCGGCGCACACCTCATCACGTACCACAACGTCACGTACATGTTGAACCTCATGCGTCGACTGCGCCA
GTCTGTTCTCGATGGAGAGTTTGAACCGTTCGTCCGCACCTTCATGCTGCAGCAATTCCCGAACCGTGACTACCCTCAATGGACTGTGGACGCGCTCGCC
GAGGCAAAGATCTCGCTCCATTG