Transcript Name :
Phyra_g12188
Orientation:
(-)
Number of Exons:
7
Description :
XP_002896000.1 helitron helicase-like protein [Phytophthora infestans T30-4
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-513
*** None ***
PositionContextScore
54GSKRERR|FR0.598
56KRERRFR|VA0.518
508PVYRRRR|RA0.544
509VYRRRRR|AE0.5
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3120 bases(100 bases per row)
TGCGGGGGTGCTTTAAAGGGATAACGGTGGATGTGAGGGACCAGAAACAAACAAAAGCAAAGCGGCAAGGCTAATGAGGTGTTTTACAGCCGTGCAGGAC
TCGGGTTCGTGGCGAGGACTGTGCAAGACTGGCGGTGCTACACGGGTATCCTGCAGGTGTGTCTCCAGAAGGCGTCTCCTTGCGAATTGCGAGGTACCGG
CCGTCCTTTTACTAACGACTGCAGTTTTGGGTGGTTGTTTTCCAATGCACGTGCGCATTTATTGGGAAGTCCACTAACGCTGCATTTGCTGTTGCAGTTG
TTGCGGACAGCACCATGGTAAATGTCGGCAGCAAGCGGGAGCGGTACGGCTGTTTCTTGGTTGTTGTCAAGTGTCCCTTGCTCAGTGGTCTCTTTTGTTA
GTGATGAGCGGCGTCAGGAGCTGGACCAGCGCCATACCCAGGCCCTCGATGCCAACGCGTCACCAGTCTCCAGCGTCTAAGAGGCGACGATTGGGGCGCC
GCCGCGCGGCTCAAAGGCGGTTTCGGGTGGCAATGGAGCAGATGGAACAACTGAGCCTACAAGAGGCGGCCGCAGGTGGGGGGGGCGTCGTCACAGTGAC
AACGGGTGAAACCGCCCCTCCTGTGCCGACGGTAGTTGGACAAGGGGCGACTAGCCAGCTCTCTGCAGGTGCTCCAGTGCAGAGGGCGACTGACCCACAA
GCAAATCCACGTCGGATGAGGGAGGCTCAGCGAGCGCGTTCCAGACGAAGTAACATGACCGACTCTCAGCGGGAGAGTGCGCGGCGGCGTGACGCGGAGC
GAAAGCTAGCCCGGCGAGCCCAGCTCCGTGCCGAGCAGCTTCAGGACGTACGAGAACGAAACCGGATCGCACAGCAGGAACGTCGGCATAATCTGAGCGA
AGAGGTCCACGCCGCGGAGCGTGAACGCAACAGTGCTTCTCGCGCGCTTCACAGGAGTGTACAGGATCGCACTGAAGAGCGCAGGACAGACCGGGAGCAA
CACGCGGACCGCCGGGTTCAGTTTACGCAGGAGGAGCGCGCTGAAGAACGTATGGTAAACCAAGAGCAACATGCCCGGCGCCGATCACAGCTTACGCAGG
AGCAGCGTGCCGAAGAACGGATGGCAAACCAGGAGCAACATGCCCAGCGCCGATCACAACTTACGCAGGAGGAACGCGCCGAAGCGCGAGGGGTAAACCA
AGAGCAACATGCGGAACGCCGCAGAGAACAGACTGAGGAAGAAGCACTGGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAG
GCGTTGGCAAACCATGAGGATTTTGACGTGGCCTACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATCGGCTTCCTCCCACCACTGTTTGTGAACATT
GTGGCGCTTGGAAGTGGCCTGGCGAATCCAAAATGAGCTGTTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGCCTGCACCTCCAAGATTGTTGCA
ACTGTACCGGGATCCAGCGTTTCGACAACACATACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTGGCGCTTCGTGCTCCAACCGATCCTTCCAG
GACGTCAACCAGGATGCAAGCGTAGCGGGACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCACTACTTGGGATCTCTACTCCCCTATA
TTGATCCCGCCACCGGAGAGCGCACGGACCCTAAGTTCGCGCAGATCTATATTGTGGACCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATCTT
TGCTGACTTGGATCCTGTGGCGTTGATGGACATTGAGCAAATGATGGAGCAGCACAACTCATTTGCTCAGCAGTTCCTGAGTTTCGGAGAGCAAGTGCGC
TCGCGAGACACGAGCGACGTCGTGGATATGGTGTTCCGCCTCCACGAAAATATAGCGCATCCTCGGACATACAATTTGCCAACCGTTTCTGAGGTAGGCG
CGACGCTCATCGAGGACGGCAACCTGGATAGGCCTCGCGATCTACTACTGTATACTCGGGATCACAGGCTTCTGCGACTGTTCGAGACGCGCCCGGAGTA
TGATACCCTCTTCTGCTTCCGTATGGGGAGCTGGGTTGGACCTACACTGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTC
GCGAACATGTCGCCTTCCGGTTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTCGACCAACGCGC
TAAATGCGAGCAGGAGCAACTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACCGAGGGCTTCAGGATGCACTGCTTAACGAAGGT
ACAATTCAGCTGGAAGCAGGCGAAGGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGAGGTGGTGATACCCAAT
TTCTCAACCAAGTGGGACGCCTCGTTATTCTGCCCTCATCTCATATGGACAGTCCTCGAGCAATGTACCAGTCCTACCAAGACTCAATGGCCATTGTTAG
AGAATTCGGCAAGCCTGATGTGTTCATGACAACGACCTGCAGCCCTACATGGGAAGAGATAGTCGAGGCCCTTGGGTCCGATCAACAAAACGCTCAGGAC
CGCCCCGATATTGTAGCCCGTGTCTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACG
TGGTCGAGTTTCAAAAGAGAGGGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCACGTACTCGCCAAATCGTAGATCGTATGGT
GTCTGCAGAGCTTCCTGACAGAGAAAAGTTCCCGCAGCTATTCGAGACAATCATGACATGCATGCTGCATGGACCCTGTGGAGCGGCAAACCCGTCATGC
GCTTGCATGAAGGACGGGAAGTGTACGAAAGGATATCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAGACGGCGTC
GACGAGCTGAAGGCGTGTAA