Transcript Name :
Phyra_g14265
Orientation:
(+)
Number of Exons:
8
Description :
OWZ12061.1 TKL/DRK protein kinase [Phytophthora megakarya
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain32.174PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain4e-24SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-601
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        4383 bases(100 bases per row)
ATGGAGCAGGACATATTGGGTAGACTACAAACTGCAGTTGTAGACTACTGGTTTTCTCGCGACCAAGCTGCACCTCAGAAGCTCATTGATTTGCTCGACG
GCGCAGAGACCTCAGTAGATATCGCTATGTTCATCTTGTCGCATCCTGAACTGACCGACGCTATCATCCGGGCCTCCCAGCGTGTCACGGTTCGTGTTCT
CGTTGATCGGGCACAAGTCACCGAGAAAAGCTCAGCAATGATAAAAAAAACTGGTTGAAAACGGGGTCAACGTATATCACGCAGGCCCCAGACTCATGCA
CTGGAAGGTAGCGATTATCGATGGAACCGTGTTGACGATGGGAAGCTGCAATTGGAGTGTGGGGGGAATGACGTTGAATTGGGAACATACTGTTGTATTG
CGTGGTCCTATTGTTGGAGCACACGCCGTTGAGTTTGACGAACACATGTGGTCTGTTGCCGTGCAAAACAACTGGCAAGTTGAGATAGATAGCCGCGGTA
ATGTTCATCTGTAGCGTCAAGCGATGGTGACAGCAGTGCCGCAGCGGGTACTCCGAGCTGGCAGTTTGGTTTACAAGGCACGGGCAACTACAGCACGGTC
GCGTTCGATGGAGCCCGCCATGCAGAGACGTTTGAGACGCGCACGGCTCAGGCGCACCTTGATTCGATCAAACGTGAGTTCGAGCTGCTCTGGGATGAAG
GACGGATTTGGGTTCTTCTGATCGTAAGTGCGCCCGCTGACAGAGTCTCTTTCTGGCACAGTCTCTTGATAGCTAACACGACGGACTTGTGCGTGCTTCT
CTACGTTTATTGCTTGCGTGAACAGTGTAACCTCGTGAGCACTAGCTTGCAACTTGCGGTAGACGCGTATCTCTCTCTTGGTGTCGGCGGTAAGAACTTG
GGCTCGACGTACATGCTTCAAGAACTAAACGTGACTGTTGTGCAGGCAAAACGCGCGAGTGCGATAGCATGTTCTTCGATGACAACGGCGGGCTGTTCGA
GCAGTCACTGCGTCTGGTGATTTCCACTGGGACGTACTTGGTGCCGAACTGGGGCGCACTGTATGTGTTTTACGTGCTGCCACGCTTCCAGTTCTCCACG
GTCTTGGACGTGCCCGGACTCCTGATGGACGACGAGTGCGACGAGGCGGCGTATGAATTGCTTTCCGGTGATGAACGCGTAAAAACCAATGTTCTAAGTA
TTACTACTAGCCTCGAAGTTCGGCGAAGCGGACCACGGAGACGGAGACGCTCTCGAACAACGGCGGAACGATGATGAGCAAGTTATGGGACGACGAAGCT
ATCATCGCTGCAAGAATCCCCAAAGAGAAAGTCCTCGTTGGGCGTCTTATCAACAGAGGAGGATTCGGTGAGGTGTATGCTGGCACGTACAACGGACAAC
CTGTCGCTGTCAAGATGCTGCTGCCAGAGCGAAAGAAGAACCTCACACAGGTCAACGCCTTCCTCTCTGAGGTGAAGCTCATGACCACGCTTGAACACCC
GCATATCGTTCAGTTTGTTGGCGTTGCGGTGGTGGTGTTAGTCGGCCGTCTATTTGATGTTAATGTTTGTTTTCTATAGACGCCTTTAGGCAGTTCTAAA
AGATCTGCCTGTCTTCCTCGAAGATTTTTTCACTTCGGTCTTTCCTTCGGTCTTGCATGTGGTGGGTGTTCCATATCCGTTACAGCGGATCCTCTCTGAG
GTCTTGTTCGGTCGATATGGGTCTTCACGCCAAGGCGAGTATTTCAGGCTCTTGCATGGTAAGCCTCCGTATCCGCTAGGAAGGGTTAACCCTCTCGGGC
ACAGCTGCGGTCCCATCGGTCTTCACGTGTAGAGTAACCAGCTCTTAACTCCGTGTGGCTCCGTTTCCGCTATATTTGGGCTTTGCTGAAGTCCTTCTGC
TGTCAATAAGCGGGCCGTCATGTCAAGAGGTTCGTATATGGACTGCTGTGTTGCACTCTGGGGAGGGGAAATCGTGAGCATAGAGGGGTCCCATCTCCTC
TGTGCTTGGTGCTTGAACGAGAACGCGAGGGGCTCACCAGGCCCGAGGCGTCTTGGTGTGTGAGATCTTGAACACGTGGGGGGTCACCGGGCCCTCCGTG
CTTTGGTGTTTGGGTTGCGTAAGCGCGATGGTTCACCATGTCATCGCGCCGTGGTACGTGCTTGTTTGGAGCGCTCCGAGGGTTACCAGGTCCTCGGTGC
GCCTTGGCGATTTAATTTTTCTTCTTGGGCAGTACGGGGCCGCCATGTCCGGTGCGTCTTGGTGTGGGTCTTGGACACACGTGGAGGTCACCAGGTCCAC
ATGCTGCGGCGATGTTGATATCAGTCTTGGTGGCAGACACCAGGCACGGCGCCGCGTCCGTGCCCGGCGTACAGGAACACCCCATCTCCCATTCCCAGCC
CCACGTTGGGGGGACTTCGTCCGAGAAGCGAGATCTTCCGAAGAGGCGCTGGAGGTATTCTTGAAACCACTTGTGCCAGAGGGCGCGAAAAGCGAAGTGT
TTGTTGGCGTTGCGTGGGATTCACTCACCGACTTGTGTGTCGTTACCGAGTTCATGACCACCGATCTGAAAGCTTTGCTGTCCCAGTACGAGGAGCAGAA
TCTGCCCGTCGGATTCGACCATGACAAGGTGAAGGTAGCACTTCACGTGGCCCACGCGCTCACGTACTTGCACTCGTGTGCTCCTCCCGTGATCCACCGC
GATCTCAAGTCGAGCAACATCTTACTCAACCAGGCTATGGATGCCAAGGTGACGGACTTTGGTATCTCTCGCGAACGCATCGATGCAACGATGACTGCTG
GCGTTGGTACGTCGCTGTGGATGGCACCGGAGGTGATGCTGGGCGAGCGCTACGACGACAAGGCAGACATGTTTTCGTTCGGCGTGGTGCTGTCTGAATT
GGACCAGCACACAACGCCGTACGCTTTCGCGAAGAATAACTCTCGCTCCGGTCAAAAGCTGCCTGATGCTGCTATCCTTCAAATGGTGGCCATGGGCAAA
CTCCGCGTCCAGTTCTCGGGTTTCGGTCCTTCGTCAATGGTGGAGCTGGGCTTTGCGTGTGTGTCTGTGGACCCGAAGCAGCGACCGACGGCGGCGGAAG
CGCTGTATCGACTACAGAAAATCTTGGCTAACGAGTTGTAGGAACACAGAAAAATACGTCCACAAGTCTTAAGCTTATGACTGTGCTGCTCTGACCAACA
ATCTCTGCTTTGACTCAAGATGATTTCAGCGATCTGTTGCATCGACTGCTCTCTCTGGCAAACTTTCTTCCGCCGCATCTGTCAAGTCGCTGACACGCTG
TTCGTGAGGCTCCATTGTAATCTGCTAGAGCCGTGGGTGTCTCTTCGGGAACGGCTAACAGGGTCACGGGTAGAGGAAGGGAAACACTGCAAGTTGAGGT
CACACGTCGAGTGTTCCTGGCTTGTCGTAGGTCGCTGGTTGCAGCATACTGTACCCATTATTCGCATCGAAAACGTTTTCCCGCAAGCAGCTACAGTAGT
ACCCACGTTCTCTTCAACGAGTCTTGGCTCCATTCGTTGGACGGTCATCAACCGACCCCAACCGACTCTACTCGTCATTCTCGATTTCTCCTCTTGGTCA
TGCAGTCAGTGAATTATTTCTCGGATGCGTCCTGCTCCTCTCCAGTTTACTTGGAGGCCACCGCGACGTCGAGCTGCGTCTCAGCGGACTGCACCGCCAC
GACGACGACCTCGGGGGACTACTACACCACGATGACGTGTCCGTCGGATGGACTTACAGGCGCTTCGGACGTATTCGGCACCACGGCCTACCTGGTGGAC
GACATGTACATCGAGACGGACTGCGTGACCCCCTACTACCTACTCGCCTACGTGGCCTCGGGGGAGTGTCAGTCGTCTGGCAGTGGGAGTGCTGCAATCG
CCACACTCTTCTCCAATGGATCGGCCCAGCTCGAGCTGTACGTGGACTCGACGTGTTCGACCGCTACCTCCACCACTTCCATTACCGACCTAACGGGCAC
CACGTGAACAAATACTACTCCAACTATGTCGGGTCGTCAACAAGTGGTGCATCTAGCGGCTCGACGGCAAGTAGTACAACAAGCGGATCAACTGTGAGTG
CAGGCAGCACGACGACTACCAGTAACACGTTCTTGGACTCCAGTGGCACGACGACAACCGACGGAAGCGGCTCGTCGAGCTCGTCCAGTGTGAGCGTCGG
CCTCATTGCGGGGATCGCTGGCGGGTGTATCATTCTCCTGTTGATTGCCATCGGATGTTGCTGCTGCTGGCGGAGACGCCGCAAGAACACGCAGCAGCAG
AATGTGCACGTGAACATTCCGAGTCCCGTGGCTTATGAGCAAATCGTGACTCCAGTCACTCAGTTCCGCGACAAGCCTCAGTA