Transcript Name :
Phyra_g14263
Orientation:
(-)
Number of Exons:
6
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ribonuclease H domain8.893PS50879
Integrase, catalytic core20.106PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2467
*** None ***
PositionContextScore
279TPGRRPR|GS0.532
1880AKARKKR|VQ0.724
1974LSYRAAR|DA0.592
TypeScore
nuclear47.8
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
RNA-DNA hybrid ribonuclease activityGO:0004523IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        8395 bases(100 bases per row)
TGGCGAAAGAAGCGAAGTCAGCGGTACCAGCAACGCCGGCGAGGTCAAGTGGAACGCGTACCGAGGGTTCGGGGCGTTCCGGTTCGTCGTTCGCGACGCC
GAGTACGTTGGCGTCGATCAACGAGCGTTCGGACAGTTTTGATGAGCCGATGGACTATTCTGACGCCAAGGAAGATGACGAAGAAGATGACCTGGAAGAT
AAGGCAGCTATGCCCGAGCTTTCGGAAGCCGCTGCAGTATCTGCAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACG
AAGTGGCTGGTCCCGAACCAGCCAACGGTTACGACGAAGATGAGTCCGACGATCACCGATCGTCGGCGATGGCCGAGGATGCGAATTCTCGACCGAATGG
CGGCCGGCCTCCTCTTAACGGAGACACCCCGGCCGCCAACCGAGTTCTGGGTCGATACCTAGAACTCATGAAGGTGAAGAGCAACTGGATGCGATCCTTC
GCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGGAGCTCAGTGGCGAGTTAACTGTGCCCGTGGAGTCGTGGAATACTCGGCAGGTGGCCGAGGACACGG
TGCAACTCCTACGCGCTATGGGATGTGAACCCCAAGTGTTCCCGTCGGAAGCAGACCTCCGAGCATGGGCACCCGAGGACGCCGCTACGGCGCTTCGCAA
GTGGAAGCAGAAGCTTCGATCGGCCTTCGGGGTGGCCGAGGCGGGAGTTAGCCGTCCACCGAACGTCCGCCACGCATCGGATCCGGTCGACCCGTCCATG
ATTCCGTTGCCAGTGACCCCTGGGAGACGCCCCAGAGGGTCGACCGAGGCCGGAATATTTTCAGCCCAAGGTGCGACGTCGACATATTTCCAAGACTCTC
ACATGGTGACGCCAAGGTCGGTCAGTCGTACAGAACGGCTGGCGAGAGAGGCCGAGGGATATCGAACCGCTCCGACTGCTGGACGAAGCGCAAGGCAGAC
GCCCAGCCGACGTTACGACCTCCGCGACGACTCATCTGACGAAGATTCGTTCGACGTCGGAGACACGGGGGGTGACTTGACGGGAGAATGGGCACGCCAA
ATTCGTGAGCTGAGCGCTGTGGAGAATGACAGTGCGACACCGAGGCTAGAGATCGCCACGCATCTCCCACTCGGAAACATCAAGCCGTACTTGGGACTCC
GCGATAAGAGCGAGAAGTCCATGCAGTGGCTCCGAGCGTTCATATACGAGATGAAAGGGACGCACACGCCGCCCAACGAATGGTGCATGGCGTTTGAATT
GAGCCTCCAAGATGGTGCTCTGCATTGGTACCGACAGCTGCCCCGCAAAACGAGACGCACGTGGAAATTGTTGAGCGATGCGTTCATTAAGTACTACTGT
TCGAGGTTCAACCAGTCTGCGAAGGCTCGGTACTACTCGGCCAAGCGAGAGGAGAAGGAGCATGTCTGCGACTACCTCAACCGACTTAACGGCTATGCTC
GCAACGCCGGAGTGCAGTTCGAGCATGGCGGTCGAGATGCAAAGGACCACGTCGAGCACTTCTTGGATTCGTGTGAAGACCGAGGTCTAGAAGAGCGTCT
GTGCCATGTCCGAGTTAAGAACATTCACGACCTCGAGGATATGATCAATGATATCCTTCGTCGCAGGGAGCGAAAATCTGGACGCGAGTCCTCGGTCCGC
CGCCCTCGAGGGCAAGAGGTAGCACGCCGACGCGATGGTGGACGCTCCGAGGATCCGCGGGACGGCTATCGCCGAGACCGACGTCACCGAGAGGACGACC
GTCGTCGAGAAGACCGTTACCGAGACGATAACCGTCGCCGGGATGACCAACAATATCGACCGAGGGTCACTCTCACTGACGCACTGACCAACATAGTGAC
AGCACTGAATGCGGGACGCTCGGTGGACGCGCGTGGAGGATACCCGGAAGCGTACAACGACGGATATGATGACACCGAGGAGTATGGGCCGGAGTCTCAC
TCTGGCGATGACGACCGATACTCCGAAGGGTACTCGGACGACGGATACGCGTCGACCGAGGACCGAGGCCACGTGGCTGCTGCAAACGACTCTGAACGTC
GCAATGCGGCTGAAGGAACGTTCGCTCGCGCCGACAACCGTCGGCCGAGGGCAAGTAACGGCCAACGCCCGTATGACCGAGACGACCAGCGCCGAAACTC
CACCGGACGCGATGGTCGACGCCAATATGGTCCATGCGCCGCCTGCGGAGGACTCACCCATTCGGCTCACTACTGCTTTAAGCGATGCAAGATGTGCAAA
CAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCCAAGAACTCACGAATCTCCTCCGAGCTAAGGTCGAGAAGAAGGACCTCTCGCCGGAATTGCAGGAAC
TCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTCCCAATCGGGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGAC
TATATGTTCGCATTCGCAGGTGTGAGCAAACGGCCTGATGACTTGAATATGGAATATGTGAAAACGACGGAAAATGTAAAGGAGAGAGGCGTAAGCCTCG
GTGAGAGTGAAGTGAATGGGCGACGTGTGGACGGAGACGGAGTGGAGCTAACCGATGCTTCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAGA
CCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGAATGGGGTGGTGGTCATCCCAGCGCTATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGGG
GCTGTAAACGACTCGCGAACGAGGATTCTGCTGGACACTGGAGCGAATGTCAGTGTGATTTCCGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTTC
CAGATCACGGTAGGAGTCTGGAAGTGCGAGGAATTAACCCAGGGGTGATGGAGACCCGCAGACGAGCACTCGTTAAAGTCACGCTAGGCTGGGAGCGTGT
GTACGAATTTGAAGTATGGGTTATGGATCACAGTGCAGGAGTGGACGTGGTCCTGGGAACAGACTTCATGATTCCAGCCGGAGTCCGGTTGGATCTGTTC
CACGGTACTGCGAGACTACCGGACGAGGTAATGGTACCCCTGGTGAAGTCGCAGAACCCAGCAGAGGCCGAGCCGTACAGCATGCAAGTGACTGGACGCC
CGACCGAAGATTTGTCGGTCCCAGGGCGTGAGTGGCGAGAATTTAGGTTACCACGACGACGGCCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGAT
TGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGAGGGCAGCCGACGATGGTGCGACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACAC
GAATCGGTACTGCTGTGGGTGAAAAAGGGTGACCTGCCGCAAGGGGATGGATACACTCGTTTGAACTCCGCTAAGTATGAGGAGTGGCAAGTCCTGGCGT
ACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGGGAACGCAAACTCTACGAACGATGGTTGGCAGATCAGCCACCAGCTGTAGAACGACGAGACTATCC
GACACCTAGCGGCATCCTACCTCGACCATCCGACGACTTGGAAGGCCTAGACGAGGGCCAGATAACGTTCGCGAATAGGGGCACTGAGGAACCGACAGAA
CGAGACCGAACGCCGTTGACGACTTCGGTGCAACCCTCTGACGAACCCGTTGGAGATAGATGGGTCGACGAAGATGACGACTCGGTGGCGACCGACACCT
CTGATGGCGCGGATACCACGTATACGAGTGAAGAGAACTCCATCCCAGTCCTCGGTGATGACCCGGAGACCCGATTGGACTCTGCCTTCGTAGCAATGAT
GCATGAGATTACCGCGGGGGACGGTTCAGGTAGTGGGAACACCGATACCAATACGTCCGAACATTTAGCGAATGAGATCGAGTTGACGGACTATGCACAC
GAGTTGGCGTTCTTACCGGACCTGACCGAAGCCTCGGAAACGGTACTGGATTATTCAGGACCGAATGTTCTGAACCCGAGCGCGACAGCCCGTCAACAAG
AAAGTCTCGTTGCGGTGTTGAAACGACACGAGAAGATCATGATTGCGAGTGGGAATGCTCTGCCACCACCGGCCTACGGTGTGGTGTGCGATATTGACGT
ACAGGGGCATCCACCCATCAAACAGAGAGCTCGGAGAACACCGCTCCGACACCTTCGGAAGCTGTACGAGCTTCTGAAAGGCTTGCTGAAAGCTCGTCTA
GTGGCGTTTTCGGACAGCCCATGGGCGTCGCCCATCGTGATCGTGCTCAAGAAGAATGGAGTTGATATTCGGTTGTGCATCGACTACAAGCTGGTGAATG
CAGTGACGGCGATTATGGAGTACGCCATGCCGTTAGTCGACGACTTGTTGACCGACCTGGAAGCCTACCTATGGTTCTGCTCGCTTGATGCGGCCAGTGG
ATTCTGGGCTATTATGATGACGATGCGGGCCCGCAAAGTCTCGGCATTCGTCTGTGCACTCGGACATTTCGAATGGCTTCGTATGCCGTTTGGATTGAAG
AATGCACCGATGATTTACCAACGAATGATTGACAATGCTCTGTGGGGTTTCGTCCAACCCAAAGGCGGCTGGCTCCACTTCTCGGAGCTTATGCGAACGG
CCGAAGCCCACGCCGAGGTTGCGCGGACAGGGGTGACCGACCCTTCATCGCGACGACTCGAGGAGTCAACAACTCGGGTGACCAAATTCGAGGCCGACCG
CGAATCCTCGGTCACGCTTGACGCAGTGAATGGGTTAGTGAACAGCCCTGTTGCCGACATGTTCTCCACCGGAGAACCGGATGAATCCTCGTTGGTGCCA
GTGTTCGACCGACGGTCGTTTGTCGATGACATCTGTTTTGGGTCCGAGACTTTCGACGCGTGCCTGGAGACGCTAGACCGACTGCTCCAACGGTTCACCG
AATGTCGCATTAGTGTGAGCTTTACGAAGAGTATCTTCGTCCAGCCAAAGGTGGATTTCCTGTCACACGAAGTCTCTGCAGAAGGTATTCGAGCCGACAC
CAAGAAGATGAAAGCAGTGACCGAGCTGCCATTCCCTGCTTCAAAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAG
GACTTCGCAGTGTATGGAGCAGCTTTGTATCAGTTGAAGGATGAAGACTTCACGCCTAGTGGCAGCCTCTCGGCGGCCAAGCGAAGCTTCGCGGCGCTCC
AACAGAAGGTTGCAGAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGGCGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTTT
GATGCAATACCATGATGACAAGTTACACCCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTA
GCGCTACTGCTGGTGTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCTA
AGACACTGTTCGGTCGAGCGACCCACTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACAGAGTCAAGGAACACGATTGCACGTTTGCTCAGCT
TCTCCAAGCTGGCCTCACAAGCTTCGTGGAATTGGAAGACTCGTTAGCCCCGGTTACACCGCCGACGAAGGGGTCACCTCCTGCTCGTATGGACCCCCAC
TTGCTTTATGCCTGCCTACCGAGGTCCTACACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTGGATACGGCAGTTGCTCGT
GGATTTTGTGGAAATTACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAA
CGGCGTCTCAGCTGCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGA
AAGGAGTCTCTGATGGTTCAACTGAATCGTCACCGAGAACTCACGACCAAGCTGCGGTCGGTGAAGTACTTGCACGTGGTCCGAGAATTCAACGCTGCAG
CAGATTCGTTGGCAAGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGACCGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGA
GGTCATCTATGAACCCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCCAAGTAGCCCGTGGAATCTCCCGCGACAGATCT
TTTTTCGACTTTGTGCGGGACGAACCCGACTACCTAACTGCAACAACCAGACACCAAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGT
CGGTGATAGAGCCGAATGGTACAGCTGAGCGAGACGAAGCGAATGGTGTGACCACCGAAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGGT
AGACCCTGGCGCTCCAAACGCAGAAGACGTTGACCCTGTGGTTATACAGGAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGG
TCGAACCTAAAAGCGGTCCTCCGAGGCGAGGAAACAGACCTCAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGCGCTTAGCGAGG
ATGGTGTACTGCATTTTCTTGGAGCGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAGACAGCGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGA
AGTACTACGGAGTTGCCACGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATAT
GCAGACGCCGAACGACACGTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGC
GACCGTTCCAGATGGTGTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGTCGGGGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATT
CGTCATGGGTAAAGCTATGTCAGACACTACCGCTCTGAGGGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCGA
CATGACCGAGACCCTCGCTTCATGAGCGAGGTGTTCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCGA
ACGGACAGCAAGAGAGGTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAAGACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATT
GATCTTCGCTATCAACAACTCTCAAGATGGCACCCGGAAGGACACTCCGTTTTACCTAGTTCATGGGTGGGACGCACAATCCACGCTGCGAGCGATGTCG
TCGTCACTCAAACGAGGATTCGGAGGCCAGACTGACGCATTGGCATGGCGCCGAGAAGTGAACCGGCAACAGGAAATCTCGTGGAAAATGGCAATGGAGT
ACCAAAGTGTCGAGAAAGCTCGGAGGGCGAGAGAACACAATGAGTCGCTGGAGCGACGTGAGAGAGCTGCAGTACCGAATGTCGACGAAAACGAGACTTC
TGACGAGTCACAGGTGGAGACGGGGGCAACGTCTGACCCCACTGTCGAAGGACCGAGGTCCCTGTTCCAACCCGGAAGCAGAGTTTGGTTGTATATGGAA
CGAGTCAAGCCAGGGTTGACCAAGAAACTGGCCCACCGATGGCATGGACCATTCAGGATCAAGAAAAAGATCGAAGAGTTTGCGTACGAGTTGGAATTGC
CAGACCGAAGTGGGTATAGGTTCTACCCGGTGGTACACGTGTCCCGACTCAAGGCCGTCAACGAATTTGGAGACCGACCGAAGAGTCGGTTAGCACCTGA
AGTGACCGAGGATACGAGACTGGACTTCGATGAGGAGTTGTTGCCTGAAGATAGCTGGGAGCCAGACCAGCTCGCTGGCGAATATGAGGTAGAAGTCATC
CTCGATGACCGATCCCCGCTGTCGACGGGCACTAGCCGCGCTGTCCGAGAGTTCAAAGTGAAGTGGAGTGGGTATGATGAACCCACGTGGGAACCTGCCT
CAAATTTGTCATGTGGCGGGCTACTTTATGATTATCTGCGGACCCGGCGTAGCGAACGACGATTGCAGATGGTTCAAGTTGCTGATGAGAACTAA