Transcript Name :
Phyra_g7162
Orientation:
(-)
Number of Exons:
1
Description :
RAW29671.1 hypothetical protein PC110_g13966 [Phytophthora cactorum
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-36
37-59
60-795
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2387 bases(100 bases per row)
TGTTGACTTCGAGTCCGAGAGCCCATCGCAGTGGCGAGGCGCACCCTCTGCTCAACTCGCACGACGCCGTCCCGCTCACCCAGCAGCAGCCGACTGCGAG
CACTCGCGTCAGCCGCTGGAGCGTTCTCGCCATCGCCTCGACGCTGCTCGTCGCCGCCGCAGTCTTCGGCATCTTCCACCCCGGCGCGTCCACGCTGCGG
AGCGTGACTACAGTGGCGCCCGACGCCAAGTTCGACTTGTTCACGCCCATCTTCAACGCCGAAGCCCCGCCCCAGAACCTCTTCAACCACACCGACGCGC
ACAAGACGCTCTTGCCGCCCAAGTTCCTGGCCCCCGGCCTCGTGGGCTCGCGTCCTATCCCGACCAATGACTGGTGGGGCAACCTGATCGGCGCCACGGT
CGGCGAGAAAACCGACGTCATCCAACCCGTGTGGACCAACCCGTACAGCGTGACCCCTTGCATCGCCATGGAGCCCTACGGCCTGACCATGAACTACCCG
TACACGACGCGTGAATTCGGAGGCGGCCTGACCGGAAACGGCGATGCCGAGATGTACTACCTGCACGGCCAAGTGCCCGAGTTTACCTTCTCCGCCACCG
AGTTCTCCGACTCCTCGCACCCGAGCTTCGAGGTGTTCGACTGGGACGATCTGAGCGTGCAGCTCCGCTTCATGTCCCGTGAAGATGATGCGAAGAAGAT
CGAGGTGACTCTCGCAAGCGGCATGGCCTTCGTCACTGCTCGATACACTGAGCTGACGCCGCGGTTCCAGACGGCGTACAACATCTCGACCATCAACGGC
CTGGACGCCACGGAGACCGTCAGCCTTCCTCTTACCAACAGCCGCTTCGTGCTGCAGTTCGACAACGGCGCAACCTGGACGCTGTACTTCTCTTCTCCGG
TCGCGCTGCACTTTGATGGCCACTCTGTGCTCGACATGGAGCGCCCATTCACTGGCATTGCTCGTGTTGCGCTGATCCCCGATGCCTCTGCGCAAGAGCA
GAACGTCTTCGACCAGACGGCGGGCTGCGTCCTCGACGGTGGCCGTGTTGAAGCCCACAATGAAGACGCCTACGCGTACGTGTGGAAGACCAGCGGCGAC
TGTGGAAACGGTTTGCTGCACTACGCCCAGGTCCACCACATCGACACGCTGGATCGCAGATACGCTGTGGAGGCTGAAGGCGTAGCTGCTCACTCCACGA
CGCGCGGACTGATGCAGGGAGTGGTGACCAAGACTGCGCCGCCCGAGTGGCGTCTTGTGGAAACGGTGGACTTCCCCGTTGACTTTTACCCGCCGCGGAA
ACCCGATGCCAGCGATGTCGAGTCGTACAAGATTAAGAAGACGCTCATCGCCGATATCGAGTCCGAGTGGTCGATCCCCCTGGGCCAGAGCTACTACTTC
AATGGCAAGGCCGCGCAGAAGTACGCGTCGATGTGTCTGATGGCTGGAGACGCCTCCATCGTCGGCGAAGACACCACGCTGCTCCCGCACTGCATCAAGA
AGTTGGAGAGCATGCTCACGCCGTTCTTGAACAACACGTGGACTAACGCGCTCAACTACGACACTATCTATCGTGGTGTGGTGAGCTCGCAGGGCTTCAC
GCTCCACGACGCCAACGTTGACTTTGGCAACACCATGTACAACGACCACCACTACCATTACGGCTACTGGGTGGTCACCGTCGCTATCATCAACAAGCTG
GACCCGACCTGGTCGAAGCTGCCCGAGCTGAACCGTATGGCGGGCTTCTTGGTGCGCGACGTCGCCAACCCGTCGGACGCGGACCCGTACTTCCCCAAGT
TCCGCAGCCTTGACTGGTATCGTGGCCACTCGTACTCGCACGGCATCACGGCGCTTGGAGATGGCAAGGACGAGGAGAGCACGTCCGAGGACATGAACTT
TTACTACGGCATGGCACTGCTGGGCAAGGCCACAGGCGACGCCCACCTTGAAACGGTTGGCAAGCTCATGGTCAAGCTCAACGCCCGCGCGATCCAGACG
TACTTCCTGATCGAGGACGGTAACCGCGCCCACCCGGACCGCTACCGTGACAACAAGGTCATGGGAATCCTTTTCGACAACAAGGTCACCTACGCGACGT
GGTTCAGCGGCGAGAAGTACGCGATCCACGGCATTCAGATGCTCCCAGTCACGGCCGTCACCGAGTTTGTGCGCACGCACGACTTCGTCTCACAGGAATG
GGACCAGGTCCTGTCGCGCGAGCCGATCGTCCAGAACGACGAGCAGACCAACCCGTGGCTCTCGCTTCTCTACATGAACTACGCCACCGTCAACAAGGCG
TTCGCGCTTGAAAAGCTGCGCAACGTCACGATGGATGACGGGCTCTCCCGCTCCTGGGCGCTGTACATTGCAGCCACCCGGCCGTAG