Transcript Name :
Phyra_g11836
Orientation:
(-)
Number of Exons:
1
Description :
POM62008.1 12-oxophytodienoate reductase [Phytophthora palmivora var. palmivora
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-384
NN-scoreoddsWeighted Score
0.621.5530.003
*** None ***
TypeScore
mitochondrial39.1
GO
*** None ***
*** None ***
*** None ***
Sequence
        1154 bases(100 bases per row)
TGGCGTCCAAGATGTTCAAGCTCTTCTCCCCATTGACGCTCGGCGGCAAGAAGAACCCCGTGCAATTGCAGCATCGAGTGGTGATGGCTCCGCTCACGAG
ACTGCGCACGGGTGAGGAAGGAGTCCCCACCGACCTCGTGGCCGAGTACTACACGCAACGCAGCACCCGCGGCGGGCTCTTGATCGCTGAGGCCACCAAC
ATTAGCCCCACCGCTCGCGGCTACTTCGGGGCCCCTGGTCTGTTTACGTCTGAGCAGGTCGCGGGCTGGAAGAAGGTCACGCAGGCAGTGCACGACAAAG
GCGGCAAGATCTTCGTGCAGCTCTGGCACTCGGGACGTGTCGGACACACTCTGAATCAGCCCAATGGAGAGCAGCCCGTGTCGTCCTCTGCGCTCCCGTT
CAAAGACGCCGCGAGCGTCGCTGTCACGCAGGAAGGCAGACGTCCGTACAGCATCCCTCGTCCTCTGGAGACACACGAGATCCCTGGCATTGCGGCCGAC
TACAAGCGCGCGGCAGAGTGCGCTATCGAGGCTGGCTTTAACGGCGTTGAGCTGCACGGCGCGAACGGCTACTTGCTGGAGCAGTTCCTGTGTGACAGTG
TCAACGACCGTACGGATGAATACGGTGGTAGCATCGAGAACCGTGCGAGGCTGACGCTTCAGGCACTTCAGGGCGTGCTGTCGAGCCTGGATTCGAGCCA
AGTGGCCATCCGAGTGTCTCCGTTCGGCAACACGTTCGGCTGCACGGACTCGGCCCCTGAGGAGACGTACAGCTACTTGATCAAGCAGCTGAGCCCGCTC
GACCTCGCGTACCTGCACATCGTGGAGCCTCGTGGTCTGCACCCGACGGCGCAGAATGTGCCTGAGGGCGGCACCACCACGTTCAGCCGCAAGCTGTACG
ACGGCGTGCTCATGACGTCGTCCGGTTTCGGTCGCACTGAAGGCATTGACGTCACGGAGAGCGGGCTGGCAGACTGCGTGGCTTACGGCCGCTCGTTCAT
CGCCAACCCCGACTTGGTGCACCGACTCGAGGTCGATGCGCCGTGGAATGTTTGCGACTACAAGACGTTCTACCCACTACCGGACGTGCCCATGTCTGCA
GGTTACACGGACTACCCCGCGCTAGAGTTGAAAGCTGAAGTTGCCAAGGCCTGA