Transcript Name :
Phyra_g11110
Orientation:
(+)
Number of Exons:
18
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Peptidase A2A, retrovirus, catalytic10.046PS50175
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2985
*** None ***
PositionContextScore
251TPGRRPR|GS0.548
1595TIARERR|AR0.543
*** None ***
GO
Biological ProcessGO IDPrediction Method
aspartic-type endopeptidase activityGO:0004190IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        16957 bases(100 bases per row)
ATGGCGAAAGGAGCGAAGTCACCGGTACCAGCAACGCTGGTGATGTCAAGTGAAACACGTACCAAGGGTTCGGGGCGTTTTGGTCCGTCGTTCGCGACGT
CGAGTACGTTGACGTCGATCAACGAGCGTTCGGATAGTTTTGACGAGCCGATGGACTATTCTGACGCCAAGGAAGATAATGAAGAAGACGATCTGGAAGA
GAAGGCAGCAATTCCCGAGCTTTCGGAAGTCGCGGCGGTATCTGCAGGATGCAGCGGAGGAGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAAC
GAAGTGGCTGGCCCGAACCAGCCAACGGTTACGACGAAGATGGGTCCGACGATCACCGATCGTCGGCGATGGCCGAGGATGCGAATTCTCGGCCGAATGG
CGGCCGGCCTCCTCTTAACGGAGACACCCCGGCCGCCAACCGAGTTCTGGGCCGATACCTAAAACTCATGAAGGTGAAGAGCAACTGGATGCGATCCTTC
GCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGGAGCTCGGTGGCGAGTTAACTGTGCCCGTGGAGTCGTGGAGTACTCGGCAGGTGGCCGAGGACACGG
TGCAACTCCTACGCGCTATGGGATGTGAACCCCAAGTGTTCCCGTCGGAAGCAGACCTCCGAGCATGGGCACCCGAGGACGCCGCTACGGCGCTCCGCAA
GTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGCGGGAGCCAGCCGTCAACTGAATGTCCGCCACGCATCGGATCCGGTCGACCCGTCCATA
ATTTTATTGCCCTCGACCCCTGGGAGACGCCCCAGAGGGTCGACCGAGGCCGGAATATTTTCGGCCCAAGGTGCGACGTCGACGTATTTCCAAGACTCTC
ACATGGTGACGCCAAGGTCGGTCAGTCGTACAGAACGACTGGCGAGAGAGGCCGAGGGATATCGAACCGCTCCGACTGCTGGACGAAGCGCAAGTCGGAC
GCCCAGCCGACGTTACGACCTCCGCGATGACTCGTCTGACGAAGATTCGTTCGACGTCGGAGACACCAGGGGTGACTTGACGGGAGAATGGGCACGCCAA
ATCCGTGAGTTGAGCTCTGTGGGGAAAGAGAGTGCGACACCAAGGCTAGAGATCGCCACGCATCTCCCACTCAGCAACATCAAGCCGTACTTGGGACTCC
ACGACAAGAGCGAGAAGTCCATGCAGTGGCTCCGAGCTTTCATATACGAGATGAAAGGGACGCACACGTCGCCCAACGAGTGGTGCATGGCGTTCGAACT
AAGTCTTCAAGATGGAGCTCTGCACTGGTACCGACAGCTGCCCCGCAAAACGAGGCGCACTTGGAAATTGTTGAGCGATGCGTTCATCAAGTACTACTGT
TCACGGTTCAACCAGTCTGCGAAGGCTCGGTACTACTCGGCAAAGCGAGAGGAGAAAAAGCATGCCTGCGACTACCTCAACCGACTCAACGGTTATGCTC
GCAACGCCGGAGTGCAGTTCGAGCATGGCGGTCGTGATGCAAAGGACCATGTCGAACACTTCTTGGGTTCGTGCGAAGACCGAGGTCTGGAAGAGCGTCT
GTGCCATGTCCGAGTCAAGAACATCCACGACCTCGAAGATATGATCAACGATATCTTCCGTCGCCGGGAGCGGATATCGGGACGCGAGTCCTCGGTCCGC
CGTCCTCGGGGACAAGAAGTGGTACGTCGACGCGACGGTGGACGCTCCGAGGAGTCGCGGGACGGCTATCGCCGCGACAGACGTCACCGAGAAGATGACC
GCCGTCGAGAAGACCGCTACCGAGACGAGAACCGTCGTCGGGATGACCAACAGTCCCGACCGAGGGTCACTCTCACTGAAGTACTGACCGACATAGTGAC
TGCGCTGAATGCGAGACGCCCGGCAGACACGCGAGGAGGATACCTAGACGTATACAACGGGGAATATGATGACACCGAGGAGTACGGACTGGAGTCTCAC
TCTGGCGATGACGACCGATATTCCGAAGGGTACTCGGACGGCGGATATGGGTCGACCGAGGACCGAGGCCACGTGGCCGCGGCAAACGACACTGAACGTT
GTAATGCGGCTGAGGGAACGTTCGCTCGCGCCGACAACCGTCGGCTGAGAGGCAATAAACGGTCCACGCCCGTATGACCGAGGTGACCAAGGCCGAAACT
CCACCGGACGCGATGGTCAACGCCAATATGGTCCATGCGCCGCCTGCGGAGGACTCACCCATTCGGCACACGACTGTTTTAAGCGATGCAAGATGTGCAA
GCAAGTTCGTGATGCCGGGAGGTGTGAAGCCTTCCAAGAACTCACGACTCTCCTCCGAGCTAAGGTCGAGAAGAAGGACCTCTCGCCGGAATTGCAGGAA
CTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTCCCAATCGGGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGA
CTATATGTTCGCATTCGCAGGTGTGTGCAAACGGCCTGATGACTTGAATATGGAATATGTGAAAACGATGGAAATTGTAGAGGAGAGAGGCGTAAGCCTC
GGTGGGAGTGAAGTGAATTGGAGACGTACGGAAGGAGACGAAGTGGAGTTAACCGAAGCTTCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAG
ACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGAATAGGGTGGTGGTCATCCCAGCGGTACGACAAGAGGAAGCGATTGCGTGTCTTTGTCAAGGG
GGCTGTGAAAGACTCGCGAACGAGGATTCTGCTGGACACGGGAGCGAATGTCAGCGTAATTTCCGCGTCATATGCGAAGCGGTTACGCTTGTGCAAAGTT
CCAGACCACGGTAGGAGTCTGGAAGTGCGGGGGATTAACCCAGGGGTGATGGAAACTCGCAGGCGAGCACTCGTCAAAGTCACCCTGGGGTGGGAACGCG
TGTACGAATTTGAAGTATGGATTATGGATCCCAGCGCAGGAGTAGACGTGGTCTTGGGAACAGATTTCATGATTCCTGCCGGAGTCCGGCTGGATCTGTT
CCACGGCACTGCGAGTCTACCAGACGAGGTAATGGTGCCCTTGGTGAAGTCGCAGAATCCGGCAGAGGCCGAGCCGTACAGCATGCGAGTGACTGGACGC
CCGACCGAGGACTTGTCGGTCCCTGGGCGTGAGTGGAGAGAATTTAGGTTACCACGACGGCGGCCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGA
TTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGAGGGCAGCCGACGATGGTGCGACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACA
CGAATCGGTACTGCTGTGGGTGAAAAAGGGTGACCTGCCGCAAGGGGATGGATACACTCGTTTGAACTCCGCTAAGTATGAGGAGTGGCAAGTCCTGGCG
TACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGGGAACGCAAACTCTACGAACGATGGTTGGCAGATCAGCCACCAGCTGTAGAACGACGAGACTATC
CGACACCTAGCGGCATCCTACCTCGACCATCCGACGACTTGGGAGGCCTAGACGAGGGCCAGATAACGTTCGCGAACAGGAACACGGAGGAACCGACAGA
ACGAGACCGAATGCCGTTGACGACTTCGGTGCAGCCCTCTGACGAACCCGTCGGAGATAGATGGGTCGACGAAGATGACGACTCGGTGCCGACCGACACC
TCTGATGGCGCGGATACCACGTATACGAGTGAAGAGATCTCCATCCCAGTCCTCGGTGATGACCCGGAGACCCGATTGGACTCTGCCTTCGTAGCAATGA
TGCATGAGATTACCACGGGGGACGGTTCAGGTGGTGAGAACACCGATACCGATACCTCCGAACATTTGGCGAATGAGATCGAGTTGACGGACTATGCACA
CGAGTTGGCGTTCTTACCAGACCTGACCGAAGCCTCGGAAACGGTACTGGATTATTCAGGACCGAATGTTCTGAACCCGAGCGCGACAGTCCGTCAACAA
GAGAGTATCGTTGCGGTGCTAAAACGACACGAGAAGATCATGATTGCGAGTGGGAACTCTCTGCCACCACCGGCCTACGGTGTGGTGTGCGATATTGACG
TACAGGGGCACCCGCCCATCAAACAGAGAGCTCGGAGAACACCGCTCCGACACCTTCGGAAGCTGTACGAGCTTCTGAAAGGCTTGCTGAAAGCTCGTCT
AGTGGCGTTTTCGGACAGCCCGTGGGCGTCGCCCATCGTGATTGTGCTCAAGAAGAATGGAGTTGATATTCGATTGTGCATCGACTACAAGCTGGTGAAT
GCAGTTACGGCGATTATGGAGTACGCCATGCCGTTGGTCGACGACTTGTTGACCGACCTGGAGGGCTACCTATGGTTATGCTCGCTAGATGCAGCCAGTG
GCTTCTGGGTCATTATGATGACGATGCGGGCCCGCAAGGTCTCAGCCTTCGTCTGTGCGCTTGGGCATTTCGAGTGGCTCCGCATGCCGTTTGGATTAAA
GAACGCACCGATGATTTACCAACGAATGATCGACAATGCTCTGTGGGGTTTCGTCCAACCGAAAGGCGGTTGGCTCCACTTCTCGGAGCTTATGCGAACG
GCCGAAGCCCACGCCGAGGCTGCACGGACAGGGATGATCGACCCTTCACTGCGACCACACCAGGATTCAACAACTCTGCCGACCAAATTCGAGGCCGACC
GAGAGTCCTCGGTCACGCTAGATGCGGTGAATCAGTTAGTGAACAGCCCGATCGCTGACATGTTCTCCACTGGAGACCTGGATGAATCCTCGTTAGTGCC
GGTGTTCGACCGGCGGTCGTTTGTCGATGATATCTGTTTTAGGTCCGAGACTTTCGACGCATGCCTGGAGACGCTAGACCGACTGCTCCAACAGTTCACC
GATTGTCGCATTAGTGTGAGTTTTACGAAGAGTATCTTCGTTCAGCCGAGGGTAGACTTCCTATCGCACGAAGTCTTTGCAGAAGGTATTCGAGCCGACA
CCAAGAAGATGAAGGCAGTGACCGAGCTGCCGTTCCCTGCTTCGAAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTACTACAGTCGGTTCATCCA
GGACTTCGCAGTGTATGGAGCAGCCTTGTACCAGCTGAAGGACGCAGACTTCACACCTAGTGGCAGCCTCTCGACGGCCAAACGAAGCTTCGCGGCGCTC
CAACAGAAGGTTGCAGAGGCACCGATCCTACGGCACTTTTTAACCGAGACAAGGAGGTGCATATCACATTATTCGCGAATGAGTGGGTATTGAGCTCCAC
TTTGATGCAATACCATGATGACAAGTTGCACCCGGTCCGATTTTGTGGCCGAGTCCTCAAGGACACCGAGATGAACTACCACCCGGCCGAGAATGAGGTC
TTAGCACTACTGCTGGTGTTGACAGTGTGCTACTCTCAGTTAGTGGGTCGGATCATCCACATCTATACGCGATTTTCGACGCTCGAATGGGTGCACAAGT
CTAAGACACTGTTCGGTCGAGCAACCCACTTTGCGGTAATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGCACGTTTGCCCA
GCTTTTGCAAGCCGGCCTTACAAGCTTCGTTGAATTGGAAGACTCGCTGGCCCTGGTTACGCCGCCTACGAAAGGGTCACCTACTGCTCATATGGACCCC
CACTTGCTCTACGCCTGCCTAGCGAGATCTAAAACTGGATTTGTGATATCGTTTGATGGTTCGGCCAAGACCGAAAAAAACGGCGGGTATGGCAGTTGCT
CCTGGATTTTGTGGAAATTACCAGAATGGACTGTAGTGACGTGACACGAGACTGAGTGCAATTTCTCGGTTGGAATCAATGGGTGACTAGTGACGTGGAT
ATATGCTGATATTTGATTGGATGCTGAAATTTTTGAGTACTGGTTATGCGCATTGCGCATGTTGAATGTGGAATTCGGCTGTGTTCCGCGGAGCGGATGC
GCTCAGGCTTTAAGATGGGCCCCCCAGATTTGGAAGGTCAGATTAGGCTCCAAACAGCCTGAAACTGGATCTATGTCTGAATCAACCCCGTCCTCAAGCG
GGTTAACGCAATGGAGTTGAAAATGCCTATGTGAATGTATCACATATGGTGTCCCGCCTTGCCTAAAGCCTGAGCGTGTGAATATCCGTGTACCCGGAGT
GCACCGTAAGTCACCAGACGCCAGACAAACAAAAAGCCCGTTGAAGAAATGCCGTGTGGACCCTCACAATGAAGTATGATTTTGGTCATGAGACCTTGAT
CACATTAGATGTCTGAACGCAGATGTCTGAACGCAGATGTCTGAACGCAGATGTCTGAACGCGGATGTCTGAACGCATGTATTATACGTGCTCAAGACTA
TCCTGTACTGTGAGGTCGTACACACTGGTTTCAGCTAAATGTCCAAGTTGAAGAACCCTGAGCGTGAGTTCGAAGTATCTACGTTCAAGGAGATTGGAAC
CTGAAAATGATGTTCAAGGTCAAGTACTTGAAAGTAGGTTTAAAGAACCCACGTTCAGACAACCCAGAACCCAATGCGAGGATTTGACTCCTTGAAGATG
GAAAGTGAACCCACGAAGTGACAGCCAGTATACTCAAACTAAGTCAAAGTCAGAAGGTCGCTATGAACGCTATGAAGAACACAGAAGAACACAGAAGAAC
ACAGAAGAACGAAGACAGACAGATACCCTTTACGAAGAAGCTAGCGATCGGCTAGCAAAGATAACAATCAGAGTTCGTTTAACCCCCTACTACGCAAGTC
GCTCAAAGTAAGTGAGCTTCCGACAAGCAGGACACGGGTCCGCCGTTCAGTTAAGGGCAGTTCGGTGCGGGGCTCTCTACAAAATTCAAGCCCAGTTGCG
AGGGGATCATTCACGTAAGTATTTGACGTGATCCTTGCATTCCCTTTATTAGTTGGACCCGCTGCGCGTACGGTAAGGGCGGGGTTTTCATTTCATATTA
ACAAGGCCTTCTTGGGTGATAGTAGCAGTCATCCCCAGGAATATTTGATAGACTGCGTTTGAGATAGGATTGTATTGGTGTGTATTATTTCCCTCATCTG
AGGGTGGTGCGCGTGTGAAGAAAAGGCTTCAGGATTGACCAGTATCCTGGGTTCAGCCTTAGTTGACTGGTGTTCAGACCCACCGTTCAAGGGTCTATAA
GAATAAGTAACGGCTGTGTGTTGTATATAACTCTGTATTTGTATTGGGTATCTGAAAGTGGTGTTGTTCCGAGTTCTCAATACCGGTTCCAGACATTGGA
GAAGTACATTCAGGAAGTGGACGTTACGCTCAGCATCTTCAAGGCCTATTTGTATTTGACAACTCATTGTGGTGATATATCCGAGCTTCCCCCGAAGCAA
TCGACGCCGATAGGGATTACACAAGGTGCCACGCCACTCTGAATCACGGTTTCAAGGAACCGCGTTCAGGGTTTACACCCCCCAGGCTTAAGTTTCAGGA
CTAAGTCTAGGCTACCGCTATACACTTGGGCGAGAAAGTTTCATCGACTTCGTCACAACTGGTGCGCGATCCCGGATTTGGGGTCTTAGGATTTCACCGG
AGTTGTTTATATTAGTAGGAATTGATTAGTTGGGTCTCGTTAACTTCTAACTACTCTCTAATGGCGGGAGGACGAGGCAAACTGAAAGGAGGACGTGGAG
ACGGCGGACAAGCAACACGTGTGTCGCGCCGAGCGCAAGGACTGCCTGCAGAAGAGCATAAGGACTTGGACACAATCGCCCGAGAACGACGTGCACGATT
GAAGGCAGAACGAGAGGCGAAGAAGGCTGAAACTGAAGACCAAGCAGTCATCGAACTGGAAGCTGCGGGAGACGTAATGTCGACTGCGGAAGCTGGTACT
GGTAACCAGCGGTCAGAGGTGAAGCCTCAACACATCTCGGAGGAGCAGTCTCAGTCAATGGAGACTGCGCAGGCGTCTGTGGGATGCGCCAACGAGGTTG
AGACCCCAGCAGTGGATTGAGTTTCGGACACTCTGCTGCCGGTTGAAGAAGAAGAAGAGCTTGCTGAGGAAATTTATGTCATCCCTGTGGAGAGATTGAT
AGCTGAAGATGTCAGGGACGCATTGCATCCAGTACCAGCGTGTCAAGATCCCTCGTCGCACGACTTAGCACCCATGCCTGAAACGGCACCGACACGCACA
CTGAGTGAAGAATCTGCGCTCCAGAACCTGAACGCGGATCCGCGTTCAAGCTTGACTGTGGAAAGTAACTCAGAGTTAGTGACCAGAGAACCTGATTCAG
CACGGGGCGAGGACACGTCGAAGGAGTTCATCGCGCGACAAGTACATCGCTGGGAACAAGTGCGCTCAGGGTTGGTCACTCCTCCGAATGTGGTGTACGA
GTGGCCAACACCTGCACTGGACTTCTCGGTATGGTTGGAAACAGCGATGAGGACGTCTGACTATCTGCGGCACCGTATGGCTCTGCCAAACCTGGATGCT
GCCTGGATCGTCGAGCCGAACCCTGAGCGGAGGACGTTTGGAATTGCTGAAGACCTGACTGCGGTCACGGTTTCTCCAACTAGGATGACTCCACGTGAAT
GTGCTGCTTTCGTGCAAACTCTCTTCTTCGAAGCTGGATTTGAGTTCATCAACGTGGTCCCAGATTGGTATCGCACTAGAGCCTCTCAGATTGTGGTTGG
ATATGTTCGCTCAGTGGTTGAGGGAGTTCAGCAGCTGATCGCGATCGAGCTCTTGGAGTGGAAACAACTCACTGTTGACTTGCCGTTCAAGATTGTCCCA
AACGCGGATGTTCTCAACCCGTCTGAAGTTTTGAATGCGATCAAGTATGAACCCATTATGAAGCTGAACGCGGAAGGTGAAAGCGAAGATCGATTGATGT
CGGATTACGAAGTAGAACTGCTGGGGAATTCGTTTGCTTCACTATGTCGACTCGTGAGCATCACAGTGCTCAGAAGTCCTCGGGGTCCCCCTGAAAGTGA
ACCTGAAGCGAAGCGCCCTCAGCGTAGACCTCCTCGCCCGCTCAGCATCTCGACACCTTCGGATCATTCGTTGCGTCCAGCCGGAGATGTAGGATATGAC
ACTGAGGATCAAGTGATGACCAGCCACAGTTCAGGAACTCTGAACGCGTCGAGCAGGATTTCCGATTCTGTCCCAAGTGTGATTGGTCCTTCAGGCACCT
CAAGTGGAACCGCATACGACACGTCACCAGGAACGCAGACATCCAGAGACAGCTCGTCCAGTTCATCCATGTTGTCGTTGGGGCGCCCAGCCTCAGCGCA
TATGTCTCACTCAGGATCAGTCCCAGTGATGATGGCAATCCAGTCTCAGGGGTACCCGGGTGCAGGATATGATGGTGGAGCGTTGGTGACGCGTACGCTG
ATCCCAGCTCGACCTGCCTCGGTGGATCAAGATGATGTCGACATGGCTGATTCAGAGAGTGCTGGCGCTCAGGATGCTGAAACCGCTTCTCAACCGAGAC
ACTCTCAAGCGCGATCGACGGTCAAGTACGGAGGCTCGGGTTTGGCACCAAGCGAATCAAGTTTGAGTGCTAGGACACCTGCACATTCGACGCGGACGAA
GTCCAGTTGCACAAGCAGATCACGTCGGTACGTTCGCACTCTTCAGCATCATCCGGAGCAGCACCAGTCGCCCTGAACGTCATGCGTCAACACCAGGAAG
CAGTTGCCCAACTCAAGGAGCAGCAAGAAGCGTTTCACGATCGGCAGTATAAAGCCCAGCTGGAAATGCAGCGCAACATGGATCGACAGCTTCAGGGTGC
TGCGTTTGAGATTCGTTCGCTGAATGAACGCACAACTCGCGCCGAGGAAGCAAGACATGCCGCTGAACAAGCTTTGCTGAATATCGAAGAAGCTCGGGTG
GAGGCTGAACGTCGCGCTCAAGCAGCTGAAGAATCGTTAGCACGACCTACTCCCAAGACGGAAGAAGCTGCACCTGAATCTCATGAAGAAGGGGCTGCCC
GGCTGGAGGAAACCATTCGTCTTGAGCGCCAACGTTTGCAGGCTGAAAATACTGAACAACTGAGGCGTGAACGGGAGCTGGGTCAACACAACTTGGAGCA
GGCTTGGCAACAACGTCTTACCGAAGTGAATGCTGAACGTGGTCACATGGAGAATGAGCGAGCTGAGCGTGACAAGGAACTGAATGAAAGCCTGAATGCG
CGCTTGGAACGCGTACAGCAAGCCATGGAGCATTTGAACCTGGAGCGGGAGCAAGAACGTGAGTCCACACTGAATCGCCAGAAATTTTTGGCCGACCAGA
ATCGCGATCTCCGAACTGTCGTCTCCCAGATTCAAGCTGGTAAGCTGACCACATCCCCTGAAGTGACAACCCCGATAATTGAGAAACCCTCAGCTGAACC
CCATTCGGCAACCAAGAGTTCGGTGGTCAGTGGCGTAATCAAGGATGGCGTGCGTCCTGATACAGAGTCGGTACCGTCGAAGAACAAAGGGACGAAGGCT
CAACCAACCACAACCACTTCAATCGTCAAAGCGGAAGGTTCCAGCAAGGAATCCAAGTCATCTGTGCCTAAGAAGACTTCATCCAAGAAATCAGCGGTCA
AGAAAAGTGCAATCAAGAAAACGAGTTTCAAGAAATCTCCGCTGAAGGAAAAGAAAGGTGCAGATCCTCCATCTTCAGATCCAGATGAATCTGATTCAGA
CTTGTCGAGCTCAGATGATGATGATTCAAGCTCAAGTGATTCAGACAGTAGCTCCAGTGATGAGGCGGATCCAAACCTAACCACTATGTCCACGACGGGT
AAAGACGGTCAAACGATTTGGACCTATCGACCGTATATTAACTACAATGCGGTTGAGAAGTTTGATGAAGATGCATCTCTCGAAGACCGAGTTGGATGGT
GGGAGCGTTTCACTGATATGGCGGATCAAGGTTTGTGGCCAGACAAGATGAAGATCAGACAGCTGAGAGGGAGAGTGTCATCGGCTCTCAGAGATTGGTA
TGTCCAGCTGCCTAAACATGTTCGTCATGACTGGAAGAAGTTGACACACCGTTTCAAGACCTTGTATTGCCGCACAACTGGTTCTTACTCGGAGCGCTAC
TACACTATGAAGATGCGTTCAGGAGAATCCGCGCTCAAGTTTTTCTATCGGCTCAACGCTGCTGCGGTCAAGGCTGAGGTGGAGTTTCAGAAGACCACCA
AGTCTCGCGAGAGGCACATTCGTCGCTTCATTAAGAAGCTGAAGGACACTCAGCTGAAGACCGCATTTCAAGGTCAGACATTCAAGAGCATGAGTGAGAT
GGAATATGCGTTGAGACGTAGCGAGGACATTTGGCGAGAAGAAGGATATGACACGCCACCGGCCAAGCAGCTGTATCAAAACAATGCTCAATCACCGCGA
TACAAGTCTCGGAAGATGGGCAGAACGTACGTTGCCAAGATTGAGCCTGAATCAGATTCTGAGGTATCTCAACGTGTCCAGTTTGAAGAATCTGAAACGG
AGGAGAAAATGTCTGTTCCTGCTACACAGGTAGTGCACGCCAAGGGACGTGGTGTTCGGCAAAATGAACCTGCCAATTCTGAAACACAACCCATGCTTAG
CCTGGAAGATGTCTCAAACGTCGTTTATCGAGCTATGGAGAATGGTGGATGGAAACCTGGGTACAATCAGCAAAATGTGCGTTCAGACAATGCACGCTCA
GGATATTCGCCACATTTTCCACCCTGTGAGAGTTGCGGTCGCCATGGACATTCGAAGGAGTACTGCTGGTCAGAAGTCATTTGTGATAAGTGCGATGAAG
TTGGTCATCCTGCGATGAACTGCCGAGTAACGCCGTGTCCTGACTGTAGCCAGTTTCATCGTGGATTCCTGTGTGAAGAATGGAAGGCGTTTCAAGCTGG
GAAAGCACATGCTCGTCAAGGCACGCTCAAGGAGTAGCCAGACCAAGTTCAAGACCAGCTACGCGAGGACACATATACGTCTGGGAAGAAGCCGTTAAAC
CTGTAAGCCCGCTGGATGGGGATCCAGCACGCGTCGGGCTCAAGAAAACCCCAGATGTGTGTGTATTAGCGTATGTTGGCCCAAGATCGAAAAAGAATCA
AGATAACCAACACTGTATGACTGCAGTTCAAGATTCAACCTTCAACCCTGTGCGTTCAGACCTAGCTGATGTCGAAGTTCCTGTGGAATATCAGCTGAAG
CCTGGAGAACGCTATGGTTTGTGGGAGGATCATGAACCTGAAGACACGCATGAGATTGCAACGGTTCATGGAGCCGTGAATGACTGTCGGACTAGTATCC
TCCTGGATACCGGTGCATCTGTGAGCATGCTGAGTTTTAACTTTGCACGTAAGCTCAAGCTCAAGCTCTGGACGCACAAACGGATGAAGGTCTTAGGCCT
GGGAGGTGTTCCGACGTATATTTCAGCTCATGCTGAGATCAAGATTACTCTTGGCCCCAGGTTGGTTTATGTTTTTCGAATTTGGGTGGCGAATATTGGT
GAAGGAGTGGATGTGTTGCTGGGCATGAATTTCATGTTCAGCGCTGGTGTGAGGCTATCGATTCGAGAAGGACTCTTGCAACTTCCAGATGAAGAGACGG
TGCTGATGTATGGTAATTCTCCCAAGGATTATATAGGCGCGGATTTGCCGGTGTGTCCAAAGCAGAATCTGTATCTACGCCCAGGTGAAAGTGCAGTGGT
TCGTGTTGACTATGGTCGATTGAACCCTCAGCGCGGACTTGTGTGGGCTGGGCGTGGTGATCGGTGGGTGACTCAGGTCATTTTCGCGGCTAGGTCTTGG
GTCACTGCGGTTAAGGTGGTGAATATCTCGGACAAGATGCTCTGGGTCGATAATTGTACACAGATTGCAAGAGTGGTTGAACATGTTTTTTTTCCCACGC
TCAGGAAGGTTTGTGCGGCCTGGAAAGAGGCAGTATCAGGAGTGGCAACAATTGATTTATGAAGCCACTTTATCTGCCCAAGCTCAGATGCGTGCTCGAC
GTCTTGAGCAGTTGGTGACTGGAAAGCAGAACCCCAGCACTCAGGTCCCTGAGTATCCGTGGCCATCCAAGATCATGATGAGGTCGACCCCTGAGACTGC
TGTGGTGAACATGGTTCGCACGAATCCCAGGCCGAAAATCTTCGAGTGACGTTTGCTGAAGAAAATTCACGAACACATTGTCCAGCCAAGCGTGAATCCA
GGACCAGGGACGCTGAAACGCAGACTGAATCAGCGGTGAAAGAAGTTGACGTCCAAGGCCCTGAACCAGACGTTCAAGAGTGTGATGATTCCGAACGAGT
GTTGGTAATGGAGGAAGACACTGGACAAGCTTCACTTTTTGAAAATACACTCTCTGAAGGTGTCACTCAAAATGAGAGCCTGAGAGAGGACCAGTCTGAA
AATGAGTTTCAAGGTTTCTCAGCTCAAGGATTTGCGAGTATGCCTGTGCAGAAACTAGAAGAGGAGTATGCGAGGTGTATGCGTGTGTCAGCTGAAGAAT
TGGATCTGGAACCACCTGTCTATATCAGGGAAGGTAGTGAGGCTATGGCTCAGCTACGTGAACACTTGATTATGTTACCTGAGGTCCAAGATTTGAGTCC
TGAGTGCAAGATCGAAGATGCGGATGTTGGCGTCTCAGGAGTCACGACGCCAGAGATGGAAATGAAGATGACGGAAATCCTGAAACGACATCGGAAGATC
TGTCTGGGAGACGGAAATGCAGCTCCAGCTCCAGCGCGAGGTATTGTGTGTGATCTGGATGTAGGGGATGCACGTCCAGTGTATGTCAAGTTGCGCCACA
TCTATCGATCAAGGTGTACGAGTTGCTCAAGAAATTCGTTGAAACGGGTCTGATTGAGCATTCCAAATCAGAGTGGGCTTCGCCAATCGTGATTGTTCTC
AAAAAAAATGGAGAGGACATCAGGATGTGTATTGATTATCGCCTGTTGAACGACTTCATCAAGCTGTCACGACACCCTCTGCCACTGATCGATGATTTGT
TGATTGGTTTTGAATCTGCGATGTGGTTTATGAGTCTCGACATGGCTAGTGGCTTCTGGGCTGTACTCATGACTGAGCGCGCGAAATTGATTTCAGCGTT
CATTTGCCCTTTTGGACACTTTCAATGGATACGAATGCCCTTCGGACTCAAGAATGCACCTCTAGTGTACCAAGCTGTGATTAACAATTGCTTGTGGGGT
TTTGTGCGCCTGCCTCCAGAAGGGGAAGCTTTGGTTGACCAAGAAGTGTTGCAGTTTTTGAACCTGAATGTTCCAAGTGCTGAACGGGACAAGACTCAGG
ATTCTGAACGCACATGTGCTGAAGGTCCTGAACTTGACAAGGTTGAACTACCAATTCTTACGGAGCAGATGACTGTATTCAAACGTAACATACCGATGCG
TTTTGTGGCAGCTGCCCGACTGGGAAGTAGTGGATGCGCAAGGATTTATCTTGGAGGATGTCACTGTGAATGATGCTGAGTATCATGGGATAATAAATGG
CCTGAAACTGGCATTATCTCGCAACGTTCAGAACCTGGTTGCAGTTGGTGATTCAAGAATTGTGATTCAGCAAGCTCAGGGCTTGATAAACTGTAATACT
CCGAACCTTCAGCGCCGACTTGCCGAGTACGAAGCTCTCAAAGCCAAATTCAAGTCAGTTCAACTGGTACACTTCAAACGCTTCTACAATCAAGCAGCAG
ATTATCTGACGTCCAAAACATTGATTTTAGGTGAGTCTTGGCGAGTTGAGGACGAAGATGAACGACTTCATCTGCAATTGGTGTCAAAAATCCCTGAGCA
AGTCATGAAACCGACTGAGACTCTGACTGGAGATAAAGATTTGAAGTTCGAAGCTGAATCGAGTCCTCTTCCTCCTGCGGCCAAGGTTCTAGCAGCGTTT
ACGCGATCTCAGGTCGAGCGATCCGGATCAACTGAACCTTTGGAACCAGGCAGAACGTTGGCGCCGAATCAAGGCTCATCAAGATGGTGACGCTTTCTTC
AAGCGGATACAAAGCTATCTGAAAGGCAAGTTGGATGAAGTTTCCCGATCTGAGGTCAAGCAACTTGCCAAGTATGCGGATTGCTATATTCTGGACTCAC
GAGAAGTGCTGTACCGCTTGGCTGCAGAAACTAAGGGACGCCCTCGTAACAGAGAGTCTGAGCTGAGACTAGTTGTTCCTGAAAACTTGCGTCCAGACAT
GTTGCACTATGTGCATGAGGATTTTCAAGGTGGGCATCAAGGCATAACTCGCACATATCAACGATTGTGTGCAGAGTGTTATTGGCCAGGTATGTTCGCT
GATGTGGAGATTTTTGTCAAAGAGTGCACTGATTGTGCGTCGGCCAAGGGACGACCTCCTAATTCTGGACCTTCACCTGGAAATATCGAACCTCAGCGCC
CGTTTGAACTAGTGTCAAAGGACTTTGTCACCCATATGCCCAAATCTGAACGCGGGAATACTTTTCTGCTCCTGTTTCAGGATTCATTTTTAGGCTATGT
GATGTGCAAACCCATGAGTTCGACCACTGCCCAAGAGGTTGCTGAGGCTTACGAGGAATGTGTGTTCAGGCGTTTCGGAGCAAGTTCAATGCTGAGGCAT
GACCAGGATCCAAGGTTCATGAGTGAAGTTTTTACCCGATTCCGGGAAATGCTGGGTAGCAGGCAACGAGCAACCCTAGCATATCGACCTCAAGCTAACG
GCCAGCAAGAGCGGTCGGTTCAAACGGTAATGCGAAGTGTCCGTGCTTATGTGGCTGAATCAGATCAAAGCGACTGGGACGATCACGCTGAACGTTTGAT
GTTTGCCCTGAACACGTCTTTTGACGCCACCCGGTTAGATACACCATTGTACTTGGTGCATGGTTGGTATGCTCAAGGGACGGTGTCAGCGATGCTTGGA
CCCAAACCTTCAGGCGTCGTTGAACGTACCGCTTACGAGTGGCGTCGGAAGTTACAACGTGACTATAGTTACGCCCCAGCCTGTGCCAAAGACCTTCAGA
TAAAGGCGAAACGACAGCGCTCAGAAGCTCAGACGGAGAAATGGAAGGAGTTGTCAGAGCGTCTCAAAGCTGGTTTCAAGGTTGGCGATGCTGTATGGCT
ATACATCCCCAAGGTGCAGACTGGGTTGAGCAGGAAGTTGGCTCATATGTGGCATGGTCCGTTCAGGATAGATGAGATGCATGATGATTTCAGAGTCAAG
CTGAGAGTCACCAACACTGGATATCGGGTCAACCCTTGGGTGCATGTGAGTCGCCTGAAACCGAGAGCTTTGTTCCTGAAACGTCCAGTTGAAGCAATCG
AGTTGGACGAGGATGATGATTTTGACACCGCTTTGTTACCCGAGGACAGCTGGGAGGCAGACAATCTGAACGACGAGTTTGAAGTTGAGAAAATTCTGGA
TCTGCGTTGGAATAAACGCACTCGAACTGCACGACGCACACGAGAGTATCTCGTGAAATGGAAGGGCTATGAAGAACCAGAATGGTTACCAGTTTCGCAA
CTGAGTTGTGGTGCTCTCCTGTATGAATTCAATCAAGGAGCTAGAGCGAGAGCTCGCTTCAGGACCATGCAGGCAGGAGATGATCATCCCAGAGCATAAA
GTGCCCCGAGCACTTGTGCCTGGATGTAGACCGCTGACTTTGTGAAACGATTGAACCTGAAACGGATTTTCATATATGTACCCTGAAGTGATGAACATGC
TGAACGTGAAAATGAGAGAAACCTGAAACCGGAATTGAAGAACGGATGACTCTGGGGCAGTTGTGACTCAGACGCGACTTTTGAAGAGAGTGTGACTTAA
AAGAAATGGATTCCAGAATTGACAATGCTGAAATGCAGGTTGGAGTGACAAGTTCTG