Transcript Name :
Phyra_g17699
Orientation:
(-)
Number of Exons:
5
Description :
ETP25916.1 hypothetical protein F441_01272 [Phytophthora parasitica CJ01A1
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-314
NN-scoreoddsWeighted Score
0.7332.8890.006
*** None ***
TypeScore
cytoplasmic52.2
GO
*** None ***
*** None ***
*** None ***
Sequence
        1933 bases(100 bases per row)
TGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCC
CACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACTGAGC
AACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTGAA
ACTCCACGTAAGCAGCTACGTTGGAAGAGAGAGCGATCCTCTCCTCCGTTGGCTTGTTGAGGTCGACACTGCCATTACGGCTCGATGTATCGTCGACCCG
TTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCAAGGAGTTGGGCGTACGGACGCCGACTCACGGACCCTACGTGCTTTAGCACGTACG
AGGATTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGT
GCATGCTTACGTCCAAAGAGCACGGTACTTGGTCTCGAATATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGA
GATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAAGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTA
AACTGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCAGAACCAATGGACCTCTCGAGTGCGACCGCTGCTGGTTC
CCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCAGAAACATCGGTCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGC
CGTCGTGGCGATACTGGGTATCGTCACGGGCAAACAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACAT
CGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAAGTAAGCTCG
AAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGATTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCAAGGAGGTGGAAA
CACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTACCAAGAGAAGGAGTT
CGTCGACGAGCTTATCGTCCTCGACTTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGAAGAAG
CGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCTCTGTCGGCGCAGCACATGCACCACGTGGTGCGTGCGGCCCTCCACCAG
AGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGGAAATGTGAACCGAATCAGCAGGGCCTGAT
TCGATCGGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACAGATAAGGTCGACACACAATTTGTCGAAAGACACTCCGCCGTTAGG
CGTAGAGGTAAAGAAGGCGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATTCTTGCGAGCTCGCGTG
CAGCCTGGCTTGGACGCGTGCGCCCGCGGGTAA