Transcript Name :
Phyra_g13906
Orientation:
(-)
Number of Exons:
3
Description :
RAW43718.1 hypothetical protein PC110_g142 [Phytophthora cactorum
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
F-box domain12.12PS50181
MATH12.567PS50144
HmmSmart predictionP-Valprediction_id
F-box domain0.00036SM00256
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-671
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        2347 bases(100 bases per row)
TGGTCGCATCGGCTCGCGCGCTCAGCCCCAAGAAGCGCCAGTGGATCGGTGGTGCCCGAACGGTCTCCAGCAAGAGCAGCAGACGCGCGCAGCACCCGCG
GCTGCTTCAGTGCCGAGTCAGCGAGGGCTCCGCGGGCGAGACGGACAGCGAGAGCCTGGATCTGGACGACGTGGACATGGACGACCTTTCCAGCGACATC
CAGACGCTGCCGGACGAGCTGCTGGCGCTGGCGCTGGCCCAGCTGGACGGCCAGTCACTGCTGGCGTGCGCCGCGACCTGCAGAACCTTCCGGACGCTCA
CGTTCGACCGACAAGTGTGGAAGCGGATCTGCCTGAAAAGGTGGCCGACGCTGAGGACGCAGCTGCTACCACAACTACCCGGGGCACCGGACTATGATGT
ACGGGTGAAATGCTGTCTTTTGAGAGCTTTGTGCAAGCAGAGAGAGCTGGAACTAAGATATTGATATTTTTGTGACCTGTGACTTTTTTAGTTGGTGAGG
CTGTATGGAGGCTGTTGGAGACGCTGCTATGAGGAAAAACACGGCATGGAACAAAGAGCAGAAATGTCCGTGAAAATACCCAAGTTTACGGACGTGGAAG
CTATGAGAAGCGTGGACAAGGTGGTGTCGGACACGTTCAACATTGGCGCGCATCGCTTTTGCCTATGGGTGTTCCCAAATGGAAACCCAAACGAGGCTCA
GTACAAGGACCGTGTACTCAGCGTGTACCTTGTACTGACTGATTTATCGCGGCGTGCACCGGACTGGCTCACGTGCGCTGTGTTCTCGTTGCAGGTGGAA
AACGCACGAGATCCAAGACGTCGACTCGAGTGGCACTCGTGTCTAACGGACAACAAGTTTCACCGACACCTCAACAACTGGGGGGTGCACTCACTTGGTT
CTCTATCGACGCTGCGTGATCCTCAGCAAGGTTTTCTTACCAACTCCACGGAGGGCCAAACCGAACCCGATATCCTCACTGTATCTGCTCAGGTTCGACT
CATGTCCATTACATTTCGCGTGATATTTGAGCACGATCTTCGAGAACACCATCAACTCGGACTCGTAGATTTTACAAACGTGGCGGAATTGGAGCTGCCT
TTCTGCTGCTCACTACGCGACTTGCTCGTCGCACTACACGACCGGTTTCCTGAAGTGCTCGGGGACTACAGTGAAGAAGGAGCGATGGCCAAGACGCGAG
TGTGGTGCTTTAACCAGCCAGTGGTGTCAGGTCAGGCACTGCGGCCACGCAAACTGCTCGCCTGTGACAAATCCCAGCAAGATCGACCTCTTTTTGGTCA
CTTGCTCTGCGATGGAGTTGACATCGACGCGTATTCGTTCTGTCAGATATACGTTGAAAACAATTCTGTGACGAATGATCTCCCGCTTGATCTACCGCCT
GGTGCCCAAGCGACTGCGAAGGATTTATTGGCGACCCCTGAAGGCTATGTGTTTGTAAAGCTTCTCCAGCCAGCTCCTGCCAACCAGCTAGACTATATCG
GCAAGTTCCGTGTTTTTGAAACATTGTGTCCCGACGGCACGACAATCCGAGGCAAGTCTGAAAGCGGACGACTCGCGCCCAGTGTGCTGTACGAGGCAGT
TGCTCGTCATACAGGTTGGAGCTGTGCACAGCTGGAAATGTTCCGAGAAGAAATTGCCCCAACTGTTGTCTCTGAATTGATCCCGTACCATGCGCCGGCT
CAAAGTGCTGGATTGCAGCAAGCGGATATTGTGGTATTCTGCGTAAGACCACAAGGTCTCCACGGAGTGCCACCTGCGAGTGCCCTGAGCCCCGTGTACG
AGCTGCTACTCGAGCGTTATGCAGAAGCACGACAACTGTTCAGTCCTACCGATTTGGCGCCGCCTACGCTAGAACTGGTTGAAAACCTGGCCGAGAAGCT
GGACATTCCAAAATTCCGCGTGCGCAGTGCGTTCCGCAAGTGCCACGAGGATCCGCTTGCTACCTTACGCTACATCATGGACGGTCGTCATCTAGGCTTT
ATCTGCGATTCGTGTGGCGAAACAGACTTCACCGGACCACGATTTAACTGCGCTATCTGCAGCGATTACGATTTATGCGCCGCGTGCAATGGTAGGCATC
TTTGCTTGAGCGCGGACGCTTTGCACGGTTGGACTAACTTGATGGCTGTGTTGTTGGTTCGAAAGCAGCGCAAGCTTGCGAGATCTCGCACCGCTACGCC
AACGTCGACGGTAAGTGGCAACGCGTGTACAATTTCAAAGACCACAAAACGTCGCACACGATGCGCAAGATGTTGCCGGTTTTCTATGGCTATGGTCGCA
ATCACGACTGGCAGCCAGCAGCAGAGGTCTATTGCCGCCATTGCTGA