Transcript Name :
Phyra_g13905
Orientation:
(+)
Number of Exons:
6
Description :
XP_008907639.1 AGC protein kinase, variant 2 [Phytophthora parasitica INRA-310
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Phox homologous domain12.011PS50195
Protein kinase domain51.156PS50011
AGC-kinase, C-terminal17.002PS51285
HmmSmart predictionP-Valprediction_id
Phox homologous domain0.000000000057SM00312
Serine/threonine- / dual specificity protein kinase, catalytic domain0SM00220
AGC-kinase, C-terminal1.1e-18SM00133
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-907
*** None ***
PositionContextScore
708SSKREKR|RS0.551
760GGHRARR|VQ0.548
790RNRRRKR|NN0.678
804HKRRWKR|KR0.637
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein serine/threonine kinase activityGO:0004674IEA
protein bindingGO:0005515IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        3702 bases(100 bases per row)
ATGCCTGCGGTCGACGAGTACCCGCGCCGTACGCCGCCCCGGGACGCCGCGGCGCGCTCGCGCTCGGCCGCCGGCAGCGCGCGCGCCCTCAGCGCCTCGT
TCCAGCACCAGGTGCAAGTGAGCGGCAGCAGCAACCTGCGCGCGTCGTACCAGGAGCCGCAGCCTTCCAAGAAGAAGCGCCACAGCAACAGCAAGAAGAG
CGCGCAGATGCGTCACTCGCTCACGCACGTGCAGGGCTCAGACGCGCAGCGCTCCAGCGCGTCGTCCACGTCCGGATCGGCGCTGTCGCCGCCCCAGCGT
GGCTCCAACTACCTCAATCTGCACACTACAGGTCGAGAGTTGAGCCCCCGCCAGCAGCTGCACCCGGAGTACCCGGCCGCGCCCCCCGCGGGCGATGACG
TTCTCAAAGTAGAGATCCCGCGGTGGAAGTCGAAGCTCACGACGGACAGGGCCGACAGACTGCACATCCCAGCAGGAGCCGACAGTGCAGGCAACTCGCC
CGTGGCCAGCGGAGCAGGCAGATCTTCGACGTGGAACGGCAAGGACGGACGAGGCGGACACGGGGGCTCCATGGGGGCGCTGGTGCTCGGACGGGACCGA
GATAACGGATCCAAGAAGCGCTATACGGTCTTCCAGGTGTACGTGCACTTCCAGTCGGGAGCTGTCCGCGTGTCTGAGAAGAGGTACAGCCACTTCCGGG
AGCTGCACAAGACGCTGAGGCGGAAATACGCAACGGTCGGGAAACTCTACTTCCCGCCCAAGAAGTTCTTCATGTCGCTGTCGCTGCGTGTGATTGAGCA
GCGCCGGGAAGCGATTGAGACGTACATGAACGCGGTACTGACCCTGCGACCACGGCCGATTGAGGTCGTACAGTTCCTCAGCAGTGGCAGCAGCTCTGTG
GACGACGAAGAAGAGGATGGCAACAGTACGGACGGACAGGCGCGCGGCGTGGATATGGTGACAGCTCCGAAGCACGTGCAGTCCACGTCCACAGCTCTTG
GGACGTCTTCGCGGCTCAGCGCCAGCAACAGTTTTGCCTCGGAGGACGCAGGGAATCATTCCGTGACGATGCAAGACTTTGAGATCCTGAAAATGCTCGG
AAAGGGGTCGTTTGGAAAGGTCTACATGGCTCGGGAGCGCGGAGGAGACGGTAAGATCTACGCGATGAAAGTGCTGCGCAAGTCGGAGTTAGTGAAACGC
AACCAGGTGGGGCACACGATGATGGAGCGCCGCATCATGAGCTCCATCGACCATCCTTTCATTGTCGGGCTCAAGTACTCGTTCCAGACCGCCAGCAAGC
TCGTGATGGTCTCGGACTATTGCTGCGGAGGCGAGATCTTCTTCCACCTGAAGAAGTTTCGCTCCTTCTCGGAAGCTATGGTGCGCTTTTACGCCGCGGA
GTTGGTGGCCGCCATTGGCCACCTGCACGAGCGTGACATCATCTACCGCGACCTCAAGCCCGAGAACATTCTTCTTGACGAGACAGGCCATGTGCGACTT
ACCGACTTTGGCCTCTCCAAAACAGACTGCACGGACTTCACAGGCGCCAAGACGTTTTGCGGCACCCCCGAGTACCTGGCACCCGAAATGCTCATTAGCC
GCAAGAAGAAGACGGAGTACGGCAAAGCCATCGACTGGTGGAGCCTTGGGACCCTCATGTACGAGATGCTCACGGGCTGGCCGCCTTTCTTTGATCGCAA
TATCGAGCAGATGTGCACCAAGATCATGAAGTCACCGCTCAAGTTCCCGGCTCACTTCGGTCTGAGCTCTGAAGTCAAAAGCCTCATTTCGGCACTGCTG
GAGCGCGATCCGACGTATCGCATCGGCTCACGCCCCGGTGCTGGCGTGGAAGACATTAAGAACCACGTGTTCTTCTCTAGCATCGACTGGAAGTTGCTAG
AGCAGCGCGGCGTCAAACCCCCGTTCAAGCCGCGTGTGCGCAGCCCGACGGACATCCAGAACTTTGACCGTGAGTTTACGAAGGAATTGCCTGATCATGG
TTTCTTGCAGCAGGATAAACGACTTGCAGTGTCACCCAAGAACGAGTTCCAGGGATTTTCCTACACTCGAACGGAGGAGCCAGCATCAATGTCACGAGAG
TCAAGCAGCAAGCGAGAAAAGCGCAGGTCAGGGCGCCGGTCGGAGCCGCGCCTTAGCGAAGGGTACGTACGAGGAAGGCATTGAAGCAGCGCTGGACGCC
GAACTACTCTTCTGGATCTTCGTAGGGGTGCCTGATTCTCTCTCTCTTGCGTCTTGGGATGGGCCTTGGGTGTTGCTAGAATCGAGCGCGAGTCCCAGTC
AGCAGCAGATCAGCAGTATCCCGAATTCGGCCTCGTCGGCCGTGACAGCACGGATTTCGACACTGGTTGTATCTAGAGTACGTGGAGGCCACCGCGCTCG
TCGTGTCCAGTACAAGAAGGAGGCAGCAGGTGGGCACCAGGAGCAAGTACATGTGATGATATTCTGTTTCTAATTAAGACTTGGTACAGGTACGGAGCCG
ATCCGAGTGGAGTCGTTCGCTGGGAGACGTGAAGTACGTTGTAAGAAAATGAATGAACCTAATTTCTCTTACCATAAGTTGTGCACACAAAACATCATCC
TAGCTATTGCTAACAATGCGCCGCGTTGTCAGCTGACGGAAAGTAGCTGCCGCCAACCTTAGAAGAAATGTGGAGACCTAACAAGGAATGTATCCCCTCT
GCATTTGAAAACGCGCTTTGAGTTCCACATTGCAGTCCGAGCTGGCTGCAGTTGGGATGCCGTGGATCAGACCCACAAATGTGGACGCAGAATCGAGATT
CAATTTTTCGCAAGGTGTTCAACTTGGACGGGATGGAGACCGCCACCCGTGAGTTCGCATACCAAATAACGACAGATGGGTATGCGGCTTCGGTGCTGCT
GCGACGTCAGGTTCTCGACCTCGCAGACACCGTCCATGCAGACACGGAAACGGCCCCAAGGCGGAAGAAACGTATGAACAGCGCGGGAGCAGCCACCGAC
AAAGGACGTCTTTGACTTGGCATTTGCGAAGTTGCCCAGTGGATACGCTCCTGATTGGCATCGACCCTGGCATGAGAACCCTGTGCACTCCGGCGTGTGT
CGGCCATCTTTCAACTCGCCGGCAGCGCAACCGACGCCGCAAGCGCAACAACAACGACAAGGACAAGCACAAGCGGCGGTGGAAGCGTAAGCGCAAGAAT
TGTCACGGCCAACGGATTGTGGAGATTAACACTAGAGAGTACTGCCATCTGGCCAAGTTGGACAAGCAACGCTTCTGGAGCCGCAATTTGAGAAAGCGTG
AGACCAGGTATCCCACGAGCTGCTTGCAGCAATACCACCCTTCAAGACCGTCGACTACGATGTCTGCGTGGATCGCCTGCAGTGCTTTCTGCAGTCCTCG
GGCTTCCTGCTATTGTTTCCGGCCCAACACTCGTTCCGCAAGTGGCGATTCCTAACGTACGGTATGAAGATGAAGGCTGGCCAAGCGTCTCGTACCGACT
CGAAGCGTGCACGTTTGTGTTGCGTGTGGAGATTGGAGCTGCCACCGGGGAAATCCGCACGGGCGTTCAGGAAGGCACTTGAGCGGCGAGCTACGGTCCT
GCCCATGGATGAATTTCGAACGAGTAAGCTGTGCCCCTGCTGCCACGAGCGCCTCCACCAAGCACGGCTGCTGACGAAGGTGAAGGACAACGACACCAAG
TA