Transcript Name :
Phyra_g6941
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ACT domain7.013PS51671
ACT domain9.484PS51671
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-75
76-95
96-109
110-132
133-183
184-206
207-1131
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
amino acid bindingGO:0016597IEA
metabolic processGO:0008152IEA
*** None ***
*** None ***
Sequence
        3784 bases(100 bases per row)
TGGCGGCGGTGGGCGCTGTGGTGGACGCCGTCTTCGGCTCATACGACGTCAAGAACGCCAAGCAGTGGCGAGACGAGGACTTGTTGCACCGCGATCAAGA
GAAGCAGTGGCGTGAGGACTCTATCCAGCGCGAGTACGAATGGCGGCGCGCCGACTTGGAGCGTGAGCGGCGCGTGGTGAAGCTCGAGAACGAGAAGCGC
ATCATCGACGCGCGCCATCGGCAGCTTGTGACCGTCTCGCAGATGTCGGCACTGCTGGCTGGCTTCACCATGTCCACGATCGTGGAGGTGCAGATCGCGG
ACGCCACGAGTCAGCCAGTGATGGTGGCGTACGGCGCCGTGTGCTGTCTAGAGGTGGGGGACGACATGTGACGAGGCATTGTGCGTCTCAATCGCTACAT
GTATTGCAGACACTGACGTTGGTTGTTGCTGCAGTTTATTGTCATGTTGATGTGCATGTTGACGTGCACGGCGCTGCTGCTGGCACTCACGCGGTTCGTG
ACGCACACGCTGGAGGGCGAGGTGCACGCGCTGTCGTCCTTGGAGCTGGACGTGGTCTCGCCCTTCTACGGCTGGTGGCTACGCAAGTGCGAGCGCGAGT
GGATCATGGCCTACCGCCTCTTCCGGACGGGGCTCTCCTTGTTCCTGGCGCAGGTGGTGCTGCTCGGCTGGGCCGTCTTCGGCGAGTGGGTGGCCGCCGC
CTCCTGCATGACGGTGCTGTGTGTGTTGGGGCTCGCCTACTTGGAGCTACGCATCGCCAGCCGATGGAGATACCTCATTCGGTTCCCGGAGACACAAGTG
CCCGGATCGCCCACATCAAGGCGGCCGACTGACGCGTCGCCTCCTCCACCAGCGCCACCACATCCTCTAACTCCATAAACATAATCGCCACACGTATCTC
GCCATCGAGGCATCCTTGCGTTGAAGCCTGCATACATGTAAATGACGAGCAAGCAAGCGCTGCCGCTCGCCTCTCCGCTTTTTCTTGTGGCCCTCCGTAT
TTGCGCAAACGTCACGGTGGCCCGGTCACGCACTCGTACGTGGCCTCCTCCCATTCATTTCGTGAAAAGCTCGGCAGGTGACAACTGAGCGCAATGGCAG
ACAAGTTCGTGGTGCACAAGTTCGGCGGCACGTCCGTGGGCAGCGCCGACTGCTTCGCCAAGGTGGCGGACATCGTGTCGGCGGTGGAGGCCCCGCGCGT
GGCCGTCGTGGTCTCGGCCATCGGCGGCAAGCCCAAGGTCACGGACCTGCTCATCTCACTGCTGGAGCTGGCCAAGCAGCGCCGCACCGCCGAGTGCGAC
GACATCCTGGCCACGCTGCGCAAGAAACACCACGACGTAGTGAGCACGCTGCTGCCTGCCGAGGTGGCCGCGCCCATCGAGAAGGCCATCGAGAGCGACC
TGCAGTCCGTCTCGGAGCTGCTGCGCTCCATCTCCATCATGCAGGCCTACAACGAGAACGTGGTGGAGTTTATCTCGGGCCACGGTGAGATCTGGTCCGC
CAAGATCCTCACGGCCGTGCTGAGCCAGCGCGTGCAGCAGGACGGCAAGAAGCATCGCTTCCGCTTCGTGGACGCCAGAGATTTCCTGACGGTCGAGCCC
GACAACGAGCACGGGCCGGTGGTGCAGTACGATCTGTCCACACAGAAGATGCAGGAGATCCTCAAGAGCGGCGAGGGCGAAGACGAACTCACGCACCTCG
TCGTCACGGGATTCATCTGTAGCACGGCGGAGGGCGTCATGACCACGCTCAAGCGCGACGGTAGTGACTTCACGGCCTCCATCTGCGGCCGTGTGCTTCA
CGCCAGCAGCGTGACGATCTGGACGGATGTGAGCGGCGTGCTGAGTGCTGACCCGCGCCGTGTGCCGGAGTCTCAGATCTTGCCGGAGATCTCGTACCAA
GAAGCCATGGAGCTCGCCTACTTCGGTGCTAAGGTCATTCACCCGAAGACCATGGCGCCGGCTATTGCTGAGGACATTCCAATCTACATCCGGAATACGT
TTGTGCCGGAACATCCGGGCACGAAGATCTCGCACCGCAACAAGGTGGAGCTCAAGCGCACCATGTCGAACGGCGCCCCCACTGCGCGCAACATTGTGAG
CGGCTTCTCCACTGTCGACGACCTGGCGCTATTTAACATTGAAGGCAGCGGCATGGTGGGCGTGCACGGCACGTCTTCGCGTCTATTCAGCGCGCTGGAC
CGCGTCAAGGTGAACGTCGTACTGATTGCCCAGGCCAGTTCGGAGCACTCGATCTGTTTTGCTGTGCCCATGGACTGCGCCGAGGTAGCCAAGGACGTCA
TTAACGAGACATTCTTCAAGGAGATCCACGTCGGACACATTGACAAGGCCGAGTACATCGCGCCGATCAGTATCATTGCCGCTGTGGGTGACCAGATGAA
CCAAACCCCAGGGGTCTGCGCTCGCTTCTTCGGCGCGTTGGGCCGGGCGAAGATCAACGTGCTCGCCATCTCGCAAGGATCGTCGGAGCGCAACATTTCT
GCTGTGGTGCGATACGAGGACTCGGCTGCCGCTCTGCGTGCCGTGCACTCGTCGTTTTTCCTTTCAGACCAGACCCTCTCCATCGGTCTGATTGGCCTTG
AGTTCGAGGAAGACGAGACCAACAGCACTGGCGTGGCTCTGCTGAAGCAGTACCACCAGCAGCGTGATTTTCTGAAGCAGCGTTTCAACGTGGACATCCG
TGTGCGTGCTATCGGTACGCACATTTCATCAAAGATGTTGCTGGACTTCGAGGGCGATGTTACGGAGGAGGCGTTGGCCACCCGCAAGGACGAGTTCGTG
CCGTTCGACCGGGACCAGTTCCTGAACCACGTTTGCGCCGACCACCTGCCGCACTGGCTGATCATTGATGTCTCTAACAGCTCGCACCACGTGAAGGATC
TGTACCCGCAGTGGTTGGCCCGCAAGGTGCACGTTATGACGTCCAACATCAACGTGTCATCGGCCACGACCGAGCAGCACCACGCTATGCAGGAGCTGGC
GGTTCACAACGAGCTCACGTACGACCCGGAGGCAACCCTGGCCATCGGTGTGCCCATTTTCAACACGATTCAGAACTTCATCCAGACCGGTGACGACATT
CAGCGGGTAGAGTACTCGGGTAGCCGCTTTCTGCATGCCATGTTCGACGCGGTGTTTGCACTTCCCGAGCCGGCCAAGGCTGACCTCGGTGCTATCATGA
AGGACCTCATGACGGAGTACAAGAACGAGTTTAGCGTGCGCGACATTGTGGACGACGTCATGGGCGTGCGTAGTGCCAAGAAGGCCATCATGATTGCTCG
CGAAATGGGCTTCGACATCGATATGAAGGACGCCAACATCGAGAGCCCATGGGAGGCGAGCGCCACGGTGGCGGGCAGCCAGGACGAGGTGGGCGCCTGG
AGCTACGACTACCTGCTGGGGCACCTTATGAAGGCTAGCGCACCGCTGAAGGAGCAGATCGCGAAGGCGGCGGTCGACCCGAATCAGGATCTGCACCTGC
GCCAGATGACCTACATCGACGCTACCACGGGCAAGATCTCTGTGCGGGTGGAGGCCCTGCCGTCGACGCACTCGTTTGCGTCGCTCAAGGGCCGCCAAGG
TGGCTTTGCCTTTTACACGCTGCGGCATTCGCTGCACCCCGTCGTGGTCACGGGTCCCATCGCAGACTGCTCGATCACGGCGGGCTCGCTCTTTGGCAGC
ACGCTGTTCCTGGCACGGAATTGCGGTGCGCGCGCTCACAACTGCGGCCACAAGCCGTGTAAGCCTTCCCTAAACAAGAATTGA