Transcript Name :
Phyra_g9755
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ribonuclease H domain9.428PS50879
Integrase, catalytic core21.567PS50994
Chromo domain/shadow11.996PS50013
HmmSmart predictionP-Valprediction_id
Chromo domain/shadow0.000026SM00298
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Chromo domain/shadowIPR000953
*** None ***
InsideOutsideTMhelix
1-983
*** None ***
PositionContextScore
260GSARVKR|SG0.845
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
RNA-DNA hybrid ribonuclease activityGO:0004523IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        2951 bases(100 bases per row)
TGCAGTCCTTCCTTGGAAGTTTGAACTACTACAGTCGTTTCATCGAAGACTTCGCGGTCTACGCCGCTGTCTTGTACGAGCTGCGCGAAGCGGATTTCCA
CGAGATAGTTCAGCAGAACAGGTCCATCCCCGGCGAACAAGTAGCTGGGGGCGTTGTCACGCGAGCAGAAGATGCTGACCGTTGGGCCCGAGCGAAAATC
GCATTCACGATGCTGAAGGCCAAGATCGTGTCCACCCCGGTACTGAAACATTTCGATCCAGATCGCACCCCGGTGATCGTAGTCTATGCGAGCCAGTGGG
CGATCTCCGCGGCACTCGTACAAGAGCATGATGGCGTGTACTGGCCAGTAACCTTCACCAGTCGTACTCTGAAGCCCAACGAGATCAACTACGGGATTGT
CGACAAGGAGGTCTTGGCACTCCTGCGGATGCTAGACGTGAATTACACACTGTTGGCGACGAGGTCGATCTTGGTGCTGTCCAGACATTCGACGCTGGCG
TGGCTGGTCAACTCGGCTGGTTTCCAGGGGAGACTGGGTAATTGGGCAGCTTTGTTGTCAGAATGGACGTTAGAGATCAGGAAGTGCACGAAAGGGGAGG
ATGAGATTCTGGGAGCGATCGCAGCAAGCATCACACCTCGCGCGGAGGTAGACGAGGCGCTGATCGCGATTGCCCCAGTGAAGCAGCCCCGACAGACGAT
CACCCTGCCACCCCCTACGGTCGAAGCGGATGAAGCCTTGCTGGTCGCGAGTTTCGACGGATCAGCGCGTGTCAAACGCAGTGGTGGCGCTTATAGCGCG
ATCGTGTGGAAGCTGCCGGGATGGACGATCGTCACGGCCGCATCGGAGTACATGCCTGATCTGACGGTGAACGAAGCTGAGTATCGCGGACTGTTGTTGT
GCTTCGATCTCCTGTCCACTATGGACAGGGGGCGGGTCGTGATCTGCGGAGACTCCAATTTAGTGATCCGGCAAATGCGTGGTGAAATCGCATGCAAGGC
CCCTGGCCTGTTGTTATTGCGCGAGAAAGCGATGGATCGGCTCCGATCGTGGCCGAGACACGAGCTCTTACATATGAAACGAGATTGGAACCAGAGTGCG
GACAAGTTAGCTAGCGAAGCTCTTCAACGAGGCGAAGGAACCGTAGTTACCTCGGAAGCTGATCGACAGGACCTGATCACACTCAATCGGCTGGACGAGC
TCCTGAAGCCGAAGGATAATAACGCTGTAGCTCGTGTATCAGCGGTAACGCGATCTGCACGACGGTCGAGACGAGTGCCGAGAGTTCTGCAAGAAGCGAT
CGTGCAACGCATCAGAAGTGAACGGATCACGCAAGCCCAAGACGAAGAGCAGTGGATCGCGAACATGAAATCGTACCTGCGGGGCGAGGTGACCGACCTG
TCGTCGAACGATGCTAAGTCCTGCGCCAAGACCGCTTGCGATTACGAGCTGGACGAGAGCGGACTCCTGCTGTACTGCCCGACAAAACCGCAATCGGACG
AAGACCGGGACTCCCTCGCGCGGCTGGTCATCCCGGAGACGCTACAACAAGACGTCCTGCATCATTATCACGCTAGCCTGGAAGGCGGGCACCAAGGGAT
CGGGAGGACTTACCAGCGCGTCAAGGCGCACTTCCACTGGAGAGGGCTGTTCAGGAGTGTTCAGCGGTTCGTGGGAGAATGTGTGGATTGTGAAACTGGG
AAAGGGCGCCCCCTCATTCAGGGAGAATCGCCAGGGAATGTACAAGCTACGTACCCATTCCAAATGATTGCCATGGACCACATTCCGTCTCTACCGAAGT
CGTACAAAGGAAACACAGAGCTGTTAATCTGGGTTGACCTTTTCACCGGATACGTGATCGCGAAGGCTAGCGCCTCTCGCACGGCCCAAACGATTGCCGA
GAATTACGAAGAATACGTCTTTCGACGTTTCGGCGCCAGTGAGGTCATCCGCCATGATCGAGAGCCCGGTTTTATGTCAGATTTCTTCCGTGCTTTTAGC
CGGATAGTGGGTCAGAAACAGAGAGCTACGATGGCGTACCGGCCGCAAGCCAACGGAACTGCCGAACGAATGGTGCAGACTCTGACGCGATCGCTGAAGA
TGTACGTGTCAGACGTGAACCAGAGAGACTGGGACGAGTACGCGGAGCGACTCACGTTCGCTCTAAACACGGCCCAGGATCGAGTTCGTGGCGACACGCC
ATTCTACTTGGCCCATGGGTGGGACCCGCGATCGACACTGGAGGCAGCGCTACCGTTAGGCAGCACGCGCCGACGTGATCAGGAGCCCCGTCGGTGGAGG
TACCACGTACAAGAACACTACCAGCGAGCGCGGGAACAGGTTCGTGAGCGACTGCGCGAGGCGATCAGAGGCAGAGCCAACCGACACAACGAAGATCTGC
GACCCCACAACATCGCGGTGGGCGCTCAGGTATGGCTACACCTCGATCGAGTCAAGGAGGGGTATGCACGGAAGCTCGCACACCTGTGGCATGGACCTTT
TCGTGTCGCCGAGATGATCGACGATCACGCCGCACGTCTTGAGATCGCGGGTTCGGAGTATAGGATCTTCCCGATCGTGCATGTGTCCAAATTGAAGTTG
GTCCGGAGGTTTCCCGATCGTCCTGACGCGCCGTTGCTTGTGGCCGAGAGCGATCGCCTGGATTTCGATGAGGCCCTCCTGCCGGAGGACAGCTGGGAGA
CCCCACTCGACGAAGGCGAGTTTGAAGTGGAGAAGATCGCGGGTGTAAGAACCGGCCGCCGGACGCGCTACGGACGAGTCCACCGAGATTTTCTGGTGTT
CTGGAAGGGTTACGACGATCCAACTTGGGTCGATGAGGCGGACCTTAATTGCGGCGCTATGTTGCGCGACTTTGAACGAGGACTGGCCAGCCGGAACAGA
TTTGAGGTGATGCAGTCCCATGAAGGGGAAGCGGAAGACCCCCTGCAGTAA