Transcript Name :
Phyra_g18151
Orientation:
(+)
Number of Exons:
8
Description :
XP_008892981.1 hypothetical protein PPTG_01427 [Phytophthora parasitica INRA-310
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Leucine-rich repeat, cysteine-containing subtype0.0025SM00367
Leucine-rich repeat, cysteine-containing subtype0.033SM00367
Leucine-rich repeat, cysteine-containing subtype51SM00367
Leucine-rich repeat, cysteine-containing subtype0.28SM00367
Leucine-rich repeat, cysteine-containing subtype620SM00367
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Leucine-rich repeat, cysteine-containing subtypeIPR006553
*** None ***
InsideOutsideTMhelix
1-341
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1547 bases(100 bases per row)
ATGGCGTTCCGACGCGACGTGATGCCGCTGGACAAGATGGTGCTCAAGTTCATCGCCAAGGCGCCGCGGCAGCTGGGCGTGATCCTCAACGAGAAGACGC
TGGAGCGTGCGCACCGCATCGGGAAGCCGGCCAAGTCGCGCACGCACAGGGCCAAGCAGGAGGTCATCCGAGCGCTGCTGCGTGGTGGGCGCCTGGGCGA
CGACACGCTGCCCGCCAGCTTTTTTCACGCCAGCATGACGCGCGTCGAGATCATCGGCGCCAAGATATCCACCCAGTTCATCGAGATGGTGCGGCGGTTG
ATGCTGGGGAAAGGGAGAGGAGAGAGATTGACGGATGGATGTGTCATTGGCTGTTTGTGCCTTTTAGCTGTCCAAGATTTGTCCGAAGCTGCACTCGGTG
AATTTCTCGGGTTGTTTTCGACTCACGGATGACGCCATTGAGCTGCTGCTGAAGAATTGTCCTGGTACGCACTGTTTTGGAGGGATTCGGTGGGTTTGTG
TGTCTGACAATGTTGGGTTTGTGGATTGCTGTAGATATTAAGGATCTCAACATTGAGAACTGCCGCAAATTGACGGACGTGACGCTGGATCATTTGCGCA
AATTCGCTCCGAAGCTGCAGGTTTGTAAATATTGCTTGTTCAAGTGAACGAGGTGGAGGTATTTTAACGCATTTTGTGCTCGGTTGGGTGGTTTTAGAGC
ATTGATGTGGGCGGAAACTTCAACATGACCATCCAGGGCATCACAAAGCTTATCGAAAAGCACCCGAACCACTCCAAGTTTGCCCGGGTGCACATCTCGG
GCCACCCGGCGACGGATCAGTACGTGCTTAATGAGGACTATGCAAAACGTGTATTGTGATGCTCACGCGTTTTGGTTATTACTTCGTAGGACAATCAAGA
TTATCATGGCAAAGTGCCGGAAGCTGCACAGCTTAAGTGTCGGCTATTGCGCCATCTCCGATGAGGCCTTGATTTCGTTGCTCAAGAAACGAGAATCGGT
ATCTCGCTTGTGCTTGCACTGGAACATAGCGATCACGTACGTCTCGTTTGAGAAACCCACTTTATGCTGCGTTCGTGCAGCTCACTTGTTTGCGTTATGG
TTCTAGTGACCAACTGCTTCGCTATCTCGGATCTGAGGCTCGAAACTTGCAGGAGCTGAACCTTTGTGGCGTCAAGAGCGTCTCGGCTGACGTAAGTATC
TTTGACAATGCCTTGCCTGGTCTACCATGACTGATTCCGTCGTCCTTGTTATTATTCCTTGCGAATTGTGTAGGCCATCGTTGCTGCCATCCATGCAAAA
AATGGTGCAAGAACCGATTTGTTAGACCTGGTAGTGCCGCAGCCTTCTCCCGATGAGAATCCTGAACCGGAGCGGAAGCGCCTCAAGAAGATCGACTTTC
GCTACACAACGTAGGTCGCATCATTTGGCATGGTGGTGTGAAGCGGAGTAGCTAACGGTGACCATGTTTGTGTTATTCTAATAGTATCACCAAGGAAGCC
GCCGCAGCTGTGAAAGAGCGCTATCCTGAGCTCCAAGTAACGTTTTG