Transcript Name :
Phyra_g1288
Orientation:
(+)
Number of Exons:
5
Description :
ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-348
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1524 bases(100 bases per row)
ATGTTGCGAACGCTATCGCCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTGGCCGA
TGGCGACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCATCTACGTTGGAAGAGAGGGGGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGC
CATAGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCAAGGAGTTGGGCGTACGGACGCCGACTC
ACGGACCCTACGTGCTTTAGCACGTACGAAGAGTTCAGGGAGGAACTCAGACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCC
TCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAA
GGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCGAATACTCTCGAGGCTGCAATTGCGCTCGCAATG
CAAGAAGAGTTTAGCCTGCGGCAGGATAAACTGCATGTGAACGCCCCGCGGCTAATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGG
ACCTCTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGTGTATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCTCGCGAGTG
CACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTTACGGGCAATAAAAAAACTAAGGGACCAGCAGGCACGGGGCGCCCTGC
TGGTGATGCGGTCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCG
AACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGTAGATCCTTT
CAAGGCTTGACTTCGAGGATGTGAAAACACCTCGAAGTCTATTGAAGTGAGGCTAGAAACGGGTGTCGTTGTTAGGACCGAGAAGCGTATCGTACGAGTA
CGCTTCTCATATCAAGAGAAGGAGTTCGTCGACAAGCTTATCGTCCTCGAACTGGACGATAAGTTCGATATGGTATTGGGCATGCCGTGGCTTGCACGGC
ATGAGCCGGTGATCGACTGGACGAAGCGCACGATCGTGCACTTCGGGAGCAGCAGCAGTGCGGCAGAGAGCGATGGCGCTGTCGGCGCAGCACATGCACC
ACGTGGTGCATGAGGCCCTCCACCAGAAACAGCGCGGGATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCAAGAGTCGTTGGAAGAAGA
TGTGAAACGAATCAGCAGGGCCTG