Transcript Name :
Phyra_g17505
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ribonuclease H domain8.893PS50879
Integrase, catalytic core20.139PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1065
*** None ***
PositionContextScore
508AKVRKKR|VQ0.619
602LSYRAAR|DA0.592
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
RNA-DNA hybrid ribonuclease activityGO:0004523IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        3440 bases(100 bases per row)
GACGCGTGCCTGGAGACGCTAGACCGACTGCTCCAACGGTTCACCGAATGTCGCATTAGTGTGAGCTTTACGAAGAGTATCTTCGTCCAGCCGAAGGTGG
ATTTCCTGTCACACGAAGTCTCTGCAGAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGACCGAGCTGCCATTCCCTGCTTCAAAAAAGGGGAT
GCAATCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGATTTCGCAGTGTATGGAGCAGCTTTGTACCAGTTGAAGGACGAAGACTTCACG
TCTAGTGGCAGCCTCTCGGCAGCCAAACGAAGCTTCGCCGCGCTCCAACAGAAGGTTGCAGAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGG
TGCATGTCACGTTATTCGCGAATGAGTGGACATTGAGCTCCACTTTGATGCAATACCATGATGACAAGCTGCACCTGGTTCGATTTTGTGGCCGAGTCCT
CAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTACTGGTGTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATC
CACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCCAAGACACTGTTCGGTCGAGCGACCCACTTCGCGGTTATGTTGTCCCCGTGGCACC
TGGTGGTCAACCGAGTCAAGGAACGCGATTGTACGTTTGCTCAGCTTCTCCAAGCTGGCCTCACAAGCTTCGTGGAGTTGGAAGACTCGTTGGCCCCAGT
TACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCTGCCTACCGAGGTCCTATACCGGATTGGTGATGTCGTTCGAT
GGTTCGGCCAAGACCGAAAAGAACGGTGGATATGGCAGTTGCTCGTGGATTTTGTGGAAATTACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATC
TCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGA
TTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTTCAACTGAATCGTCACCGAGAACTCACGACCAAGCTG
CGGTCGGTGAAGTACTTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGCAAGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGA
CCGAGGCTAGGAAATTAGAATTGGTCAAGCTGAACCGGATCGGAGAGGTCATCTATGAACCCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAG
CTTCGCCCGAGCCCAAGTAGCCCGTGGGATCTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACGAACCCGACTACCTAACTGCAACAACCAGAAAC
CAAGCAAAAGTGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCCGAATGGTACGGCTGAGCGAGACGAAGCGAATGGTGTGACCA
CCGAAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGGGCGACCCTGGCGCTCCAAACGCAGAAGACGTTGACCCTGTGGTTATACAGGAAGA
GCGCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCCGAGGCGAGGAAACAGACCTAAGCTACAGAGCA
GCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGATGGTGTACTGTATTTTCTTGGAACGAACCGTCGGTGGGGAAACGAACGCCGAG
AGGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTGCCACGACTCGTTGGAAGGGGGCCACCAAGGTATCGGTCG
AACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACACGTCAAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGC
CGACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGTC
GGGGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGCTATGTCAGACACTACCGCCCTGAGGGTCGCACAGGCTTT
CGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCGACATGACCGAGACCCTCGCTTCATGAGCGAGGTGTTCCAGACCTTTGCAGAAATG
ATGCAGTCTCGGTCAAGAGCGACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAGAGGTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTACG
CAGAATACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATTGATCTTCGCTATCAACAACTCTCAAGATGGCACCCGGAAGGACACTCCGTTTTA
CCTAGTTCATGGATGGGACGCACAATCCACGCTGCGAGCGATGTCGTCGTCACTCAAACGAGGATTCGGAGGCCAGACTGACGCATTGGCATGGCGCCGA
GAAGTGAACCGGCAACAGGAAATCTCGTGGAAAATGGCAATGGAGTACCAAAGTGTCGAGAAAGCTCGGAGGGCGAGAGAACACAATGAGTCGCTGGAGC
GACGTGAGAGAGCTGCAGTACCGAATGTCGACGAAAACGAGACTTCTGACGAGTCACAGGTGGAGACGGGGGCAACATCGGATCCCACTGTCGAAGGACC
GAGGTCTCTGTTCCAACCCGGAAGCAGAGTTTGGTTGTATATGGAACGAGTCAAGCCAGGGTTGACCAAGAAGCTCGCCCACCGATGGCATGGACCATTC
AGGATCAAGAAAAAGATCGAAGAGTTTGCGTACGAGTTGGAGTTGCCAGACCGAAGTGGGTATAGGTTCTACCCGGTGGTGCACGTGTCCCGACTCAAGG
CCGTCAACGAATTTGGAGACCGACCGAAGAGTCAGTTAGCACCTGAAGTGACCGAGGATACGAGACTGGACTTCGATGAGGAGTTGTTGCCTGAAGATAG
CTGGGAGCCAGACCAGCTCGCTGGCGAATATGAGGTAGAAGCCATCCTCGATGACCGATCCCCGCTGTCGACGGGCACTAGCCGCGCTGTCCGAGAGTTC
AAAGTGAAGTGGAGTGGGTATGATGAACCCACGTGGGAACCTGCCTCAAATTTGTCATGTGGCGGGCTACTTTATGATTATCTGCGGACCCGGCGTAGCG
AACGACGATTGCAGATGGTTCAAGTTGCTGATGAGAACTA