Transcript Name :
Phyra_g12316
Orientation:
(-)
Number of Exons:
1
Description :
XP_009535314.1 hypothetical protein PHYSODRAFT_525670 [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-630
631-653
654-666
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2000 bases(100 bases per row)
TGAAGCCTTTCCGTTGGTCCCACCTTTGCACGACTGCTGTCGCGCTCGTGGTGGCTTCGCTGCAACAGGTTCAAGTCGATGCCTGCACAGCAATTGCTGT
GACTCAAGGAGCAAGCGCAGACAACTCGACGCTGATCGCGCACACGGACGATGCCGGTGATGCAGCCTCTGATCTGCGCCTTGTTCGCGTTCCGGCGCAA
GATCATGAGCCGGGCAGCAAGCGTGCCGTCTACAACTTCAACGGCGGATACCCGAGAGTAGTGGCGCCGGACCGTGGCCCCCACTACCAGCCTGTGCACG
ACCCACTAGCAGAGGTGGAGCAGGAGTACATGATGCCGCTTGGGTACGTCCCGCAGGTGGAGCACACGTATGGGTACTTCGACCAGGACTATGGCATGAT
GAACGAGGTGCAGCTCAGCATTGGCGAAAGTACATGCGGGGCCAAGACCGCCGGGTGGCCGCTGAATGTGCCTGGAGGCAAGAACATGTTCGGCATCGCA
GAGCTCACCAAGATCGCACTTGAACGCTGTGCGACTGCGCGCTGCGCTGTGGGCACCATGGGGACGCTGGCCGAGAAGTACGGCTTCTACAGCGAAGACA
GCGGAGATATGGCGAAACCAGACTTCGGCGACTCGGCTGAAGCGCTTGTCGTTGGAGATAAGCTGGGTGAGGTCTGGGTCTTCCACGTCATGACCGGCAA
GGACGAAGCTGGAGCTGTGTGGGCAGCGCAGCGCGTGCCTGACGGTCATGTGACGGTGATTGCCAACGGCTTCACGATCCGTGAAATCGACCTGAGCCAG
CCCGACTGGTTCATGGCCTCGAGTAATGTGCGCTCGCTTGCTGAAGAAATGAACTGGTGGGACCCGAAGGGGGACAAGCCCTTCGACTTCACTGCCGCCT
ACGGCTTTGCGGACAAGGATGCCATCGGCCCGCTTTACACTGGACGCCGCGTGTGGCGCGTTTTCGACGTGCTGGCTCCGTCGCTGCAGCTCGATGCCCG
TCTCGGCAGCTTCTCGCAGTACGCCACCTACCCGTTCTCCGTGAAGCCCGACCGCAATGTGGAGATGTTCCAGATCATGGATCTACTCCGCGACCACTAC
GAAAACACGCGCTACGACATGACCAAGGGCTTGGCTGCTGGCCCCTTCGGAGCCCCTGTGCGATGGTCGGGTAGCCCCGGTGGCGTCATTGGCGGCTGGG
AACGACCGATCTCGATGTACCGCACGCTGTTTGCCTTCGTTCTGCAGAGTCGTAGTAACAAGGGGCCGGATGCTGTTGGTGGCGTTGCATGGTATGCTCA
GGATGCCCCGCACGGCTCGGTCTTCGTTCCGTTCTCCTGCGCGCAGCACGATGTGCCCAAGTCGTATTTGCTGGGCCAACAAAGCAAGTTCAACCCGCAG
TCTGCCTGGTGGGCCTTCAACTTCGTGAACAACTGGAGTCTGCTCCGCTACAACTCGATGAGCATCGACATTCGAGGCAAGATCGACAGTTTGCAGAAGG
AGGCCTTTGCCCGACGACGCAAGATGGAGAAGGAGGCGCACGAAAAGCGTCACTCTGGTAGCGTGAGTGACACCGAGCTGGTTACCCGCCTGCAAGCGCA
GAGCAACGAGTTCGCGGAGCAGGTCGTGGCGCAGTGGTGGGAACTCGCATGGACGTTGGTGGCCAAGTACAGCGACGGCTACAAGACGACGGGCGAAGCT
CCCGACCAGATGGCCTCGATCGGATACCCGGCTTGGTGGCTGCAGGCCAGCGAGTTCGCGACGTGGCCCGGCGACACCTTCAAGCCCAAGGCCAGCATGC
GCAAGCAACTCGTGGCCGTTGACAGCGCGACGGCGCAGGGTTTCGTTCGACAGGCAGCGATGGCCGAGAACGTGGAGGTGGAGGGCCGGAGCTACCCTGT
CGCCGTCGGCTGGCTCATGCTGGGAGCGGTGCTGGGCGCCGGCATGCTCGCGCTTGCTAAAAGAGAAAGTCGCCGTGCCGGCTACCATGCCGTGGCGTAG