Transcript Name :
Phyra_g11354
Orientation:
(-)
Number of Exons:
10
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Reverse transcriptase12.893PS50878
Integrase, catalytic core14.105PS50994
Reverse transcriptase10.188PS50878
Integrase, catalytic core19.786PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2229
*** None ***
PositionContextScore
13SWRRFAR|EL0.637
1081MVGRKPR|HR0.504
1191ARRRQRR|RV0.784
2033QTERVNR|VV0.562
*** None ***
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        14380 bases(100 bases per row)
TGTCGCTCCCAGTCACAAGCTGGAGGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTG
TGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTT
AAAGCGAGCTCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGA
TTGATCTCGTGCCGGGAACGAAGTATTGCGTCACGCTACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAA
TGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAG
CTGAACGATGCGACGGTACCGGCGCAAACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGA
GAGACGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCA
GGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATT
CACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACC
TGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAA
TGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGC
CCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGA
TCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCG
TGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCA
AAATTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAA
TGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGA
TTATGCGGTGCAAGAGGCCGACGACTACACCCTCGTCGTCCTTGTTGGATGACGTGAAGGCCGCATACGCGCATGATGCGGATGCGAAGCAGTTGTTGGA
GTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCTCGTGAACACCGTTATCGTGTACACAATGGTCTGCTGCTTTAC
AGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGTGACGGAACGCTCCTGTGTGAAGGCGGCTAAATATACCTGCACGGAGATGTTTTCTT
GAGGAAGCAAATTCTGAAGTGATTCATTATGAGGCTTAAGTATGGAAAACGTGGTACCGTACATCTGGTGACGTCTATCGAGAATACGATAAGTTCAGGC
TGGCTACTTCAACACTTCCCCACCAGCGCTGGATGTCAATTCTTCGATGCCAATTGCTTCACGGCGTTCACTAAATTGTGTAGATCCAAGAGCCTTGGTC
AGTCCATCAGCTAACATAATTGCAGTTGGACAGTACTTGAGCTGTAGATGCCCAGATTGGATAGCATCCCGTATCGAGAAGATGCTACAATCAACTGTCT
TTTGTGCCTCGGAATTTTTTCCGTTTAACAGTCTTTGAATGGTTGACTTGTTGTCAATCATCGCTGGAATTGCGTCGAGAGCTTGAGTTTTCATCAGTCT
TTGAAGCAGCATCCGTGTCCATAATGCTTCTTCTACTCCATCATCCGCTGCAATGTATTCAGCAATTGTAGAGGACTTGGAAACAAGTCGTTGTCGTTTT
GTTTGCCAAGACACAGAGTTACCGAAAACTTGAACGAGAACTCCAGAGATTGATCGCCGATCTTCCTCGTTATTGGCCCAGTCAGCGTCCGTGTACACTC
TGGCGGGGACAGTTGACTTATTTCTCTTGTAGATCAAGCCCATGTTCTTGGTTCCTTCAATGTACCTGAGAATATTTTTCACGGCAATCCAGTGAGACTG
AGCTGGACTTGAGGCATGCGCAGCAACCTGGTTCACCGCAAATGCAATGTCGGGCCTGGTAACGCGCGCGAGATAGAGAAGGGCTCCGACAGCCTGTCAA
TAAGGGTTTTCTTGATCTTCATCATCATGTTGAGTTCGTTTGTATAAAATCGTGCCTTGATCTAACGGGGTCTTTCGGGGTCGACAATCTTCCATACCGA
AACGTCGCAGTATTTCTGATGCGAATTGGGTTTGGTCGAGAGTGGTGATTCCACGAGCTGTATCCATGTTTATGCGTATGCCGAGAAACCACCGTACGTC
TCCAAGATCTTTGATCTGGTACTTGGAATAAAGAGCTTGCATCAAATGTTCTAGTACCTGCTCATCATGATAACCTATTAGAATATCATCGACGTAGATA
AGAACAATTAGTTCGTTAGTTGGATGGGTGTACACGCACGGATCCTCCCTTGTTGAACACAATCCATACTCGATGAGACAACTGTTGAGCTCCACATTCC
ACTCCCGGCCGGCTTGTTTAAGGCCGTATAATGCCTTTTTGAGTCGCCACACATGGGATCGACTTACTTCCTCAAACCCGCGGGGCTGCCGGACATAAAG
TACTTCGGACAACGCTGCCTTGACGTACGCCGTAGGAACATCGCCTTGGCGTACGCGCATCCCTTTTTGAGTAGCCAACGCAAGAAATACACGGATGGAG
TTCAGCTTGGCAACCGGGGTGTATGTTTCAAAATAATCTTTTAGGAACTCTTGGGTGAAGCCTTGAGCGCAGATTCGTGCTTTCAATCGCTCGACTTCCC
CACTTTCGCCCAACTTAACTCGGAATACGATCGTTGACCCAATTATGTGAGCTCCAACTGGCGGTTCGACGATATCAAAAGTATCGTTTGCCCTAAGAGC
TTTGATTTCGTCCTGGATGGCCTGTTCCCAAAGGTGCCACTCAGTGGAGGCCTTTGCTTCTTTTAAATTCAGGGGTTCTTGAATTACCTCACGAAGTGTA
ACATGAGCAGCGCTGAGTACGAGACCGAGTGATCTGTTTGCAATACGTTCTGATCGCCGAAGATGTGTAGGTATCTCAAAACCATTAAGAGCTGCCACTT
GGTGTGGGGTCAAGCCAGGTCCCACGGAGTCACGCATTGTGTTGCCAGCAACTCGTAATTCACGTCTTGGGGATCTAGGTTCATCAGTTACATTATTGAT
GTCCTCGTATTCCGATTGGATCTCGCAGTTATCAGGAACAACTAGCAACGGGTCATCTTTTGGGTCAGAATACTCCGCTGGTAAATTGGCTTTTGGTGGT
TCCAGAAAAATCACACTTCGACTGTGTATCACTTGATTACCGTGTCCCGTAACGTACACAAAGTATCCCTTTCTTTGAGGGTCACTCCCGATGAAGACGC
CCGTCCTGCCTTTAGGTCGAAACTTATAAGCCGTTGATCGCTTCTCCGGAGGTATAAGTACAACGCAGCGCTGGCCAAACGTTTTGATCAACTTTAAGTC
GGGTCTTCTCCCCCAAAACTTTTCAAAGGGCGTCTAGGTTGGGTCGGAGCGAGAAAGAACTCGATTTCGGGAATACACGGCACTTCGAATGGCATATTCC
CACAAGTAATGTGGGAGTTGAGCTTGTAACATTAGTGCACGAGCTGCATCAGCAATGGTTCGATGTGTTCGCTCGATGACGCCATTTTGGTGATGAACAT
CAGGTTCAGACATTTCCATCGCTATTCCATCACCCCCGCAAACCATTCGGAAGTCTCCAGCTGTAAATTCACCACCATTATCGGATCTGTATACTTTGAT
TCCGTCCAATCTGTTGAAACGTCGATTAACGATGTTCATGTAGTGCTGAAAACAGACTGCAGCCTCACTCTTGGTCTTGATGAAGTACACGGTTGTGTGT
CCCTTCCACTTTAGCGCGTAATAATACCTGTTGCCATGATAGCTTGCTGTGAAGGGGCCTGCCAGATCTCCATGGCAGACTTCATCTTGAGCATCGAGTG
GTCTTGAGGCTTGGTGTGGAGCGGGTGCACGAGAAATTTTTGCTTGCGCGCACACTTCACAAGGCTTTGAGGGTTGAAGAGAGCCCACGATTTTGAGCCC
TTTTACAGCATCAGACTTTGACAATTCAGCGACAGAGCGGTAGTTCAAGTGTCCGAGCCTTTGATTCCAGTCCTCGATTGAGTTCGGACGCAATGCACAG
GCTGCCATGCCTGGCGGAATGTCCAAAGTGTATACACCTCGCTGAACAGATCCTCGCATAAGTGGTTTGTCATAAATTAGACACTCCTTGTCCGTGAATT
TGTTGATGAGCATCCTCCCCTTTTGGTTGCCACACACTAACGCTCCATCAGCAATTTCAACAGCATGTGGCTCGCATTTTCGAAGATCAAAAAGCTTGTT
GCGTGTTCCAGTCACGTGGTAGGTGGAGCCGGAATCTATGATCGGGGCACCATCGGAAATCCCAGGGTCAAATACGTGAACCTTGGGGTCCGATGGCTCC
CTCGACCATCAGTCAAAAGAGCTTGGCTCGCCGCCCTTGTCACCTTGCACGTCACCACGATCACTTGACTTGATGTCAATGCTGTCACTGGCAAGGTAAG
CCATACCACTCGACTGACGCGCCACATACCTGTCATGAAAACCTGTCGTATGACCGAGTTCTCCTCAGGTGCCGCAGCGCATCTTTGAGTAATCTCGTTT
CTTGAAAGCACCTTCCCTTTTGATTTCTCCTTCTGCCACCCTTCTCTTCCCCAGGTTCGATTTTGCGTTAGCGCTAGTGTTGGATGGCTGTAATTTTGTG
GCTGGTGCAGACTGTCGCGACGGGAAAGATAGAACGCCTTGATGACCAGCGATTGTGCACAGTCGCGAGATAACTCGATCAAATTCACGCACGGGGTGAC
TCGAGTCCTCTCTCATGACCATGCGCAAGTTGTCAGTGTGCTTGCGCCAAGCGTTCACAATGAAAGAACTGAGCGCTAAATTGTTTGAGTCCTTTGTCTC
GAAACCATCTGATGAGGTTGCTGCAGCCATGGTCCGAAGGCGTAACGAGTACTCACGATACGTTTCAGAGTTCTCCTTTTTCTCGTTTGCCACTAACTGT
CCAATCTGTGCCTTGGACAACTTGCTGCCGAACTCCCGCTTCAACTCTTGCCCAAGACTGGTAAATGTGCGCAAGCGAAGATCCGATAGGTTTGAGATGT
ACCATTGGCTGGCAGCGCCACTTAGATGCTGAAAGATCAGGGCGTTCTTCATACGCTCTGGTAGGCGTACTTGATGGAGATCTTCCTGCATTTCCAGTAG
CGCTTCGGAGCGCGTGAACCACGTGGCCACTCCTGAGACAATCGCTCCTTGTTCAACGGAGCCATCAAACGGTTCAATTTTGAACGTTTTGATGACACGA
CCAAAATTTGGTTCGGTTTGTGAAGTGCTTGATGCCCCAGTGCCTTGCCTTGGTTCGGTTCGATGTTGGGGTGAAGTGGTTGACTCCCCAGTAGCTCGCG
TGAACTCCTGTTCTGGCTGCACTTGGGCCTGAAGTCGCTGTCGCAGTAACCCCTGCTGCACTAGGGCCTGAATCTGTTGTCGCTGCAACTCCTCTTGTAG
GTTGTTGTATCCTCCCTGGTTGTCTGGACCGACTCCAGTTGTGCCTGTTGTGAGTTGGTGTTCGTCATGATGGTCACTCATTGCTGCTAAAGCTTGCGGC
TGTTAACCTGACGGAACGCTCCTGTGTGAAGGCGGCTAAGTATACCTGCACGGAGATGTTTTTTGAGGAAGCCAATTCTGAAGTGATTCATTATGAGGCT
TCAGTATGGAAAACGTGGTACCGTACATCTGGTGACATATATCGAGAATACGATAAGTTCAGGCTGGCTACTTCAACAGGATGATCATGAGTTGAAGCTC
AAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTACTTCTCACGCGTGACTTCTACTGGAGTCACCAGT
ACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTC
GGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAG
ATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACA
TCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCA
GACCGACGGACAAACAGAGCGTGTCAACCGCGTGTTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCG
GAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGG
TAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAACACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACG
TACTGCGCGCAGTCATGGCGACGACAAGACAGTTTCTACGACGGGCGTGTGAAAACGTCGATGAGCGTTCGAAGGCACGATGGGCTCAGTACGACTCCCA
ACGCCGTCACCAGAAGGCAGCGAAACGATTGACACCAGCAAGCACAGCTCGAAAAACGGTTAGCAGCACTCCCCGTGTCCGAAAAACCCTGTTCGACACA
CCTCAAAGTGGCGTGGAGCGCATGACCTCAAGAAAGAGAGCGCGAGCTTCTCCAGTTAAGTCGCTCAAGCAACGCGAAGAGGATAATTTTTGCGGGTTGC
AATGGGATTTAGTGCAACGGGGATTCCATTTCGAGTAATTGATGATCCTCATTTTAGAGCAATGTTTGACTACAAGCTTCCTTCTCGTCGTCAAATTTCT
GGTCGCCTGCTTGACACGCTTTTTGCTCGTGAATTAGCCCGAATTATTTCGTTGATGCGTGGGGTTACCGAATGGGCACTTGTAACGGATGGTTGGTCAA
ATGTGAACGGCGACGGCATGATAAATTTCGTGTTTGTGAATCCCAAAATGCCGCCGGTATTTTGGAAGTCAATCAATTCAAAGGCCGAAGTGCATTCAGG
GCGCTACATTGCCGATACTATTTTGTCCGTAATCGTTGAGCTAGAAGAGCATATTGGGGCTGGTGTAGTCACTGCCGTTGTGACCGATAATGCCGCCAAT
ATGAAAAAAGCGGGGAAGTTTGTCCGGAAAGAGCGGGGACGAATAATTTGCACTGGGTGCACGGCACACGGAATGAATTTGTTGATGAAAGACGTCTTCA
AGCTGGAGTTTTTAAAGGATGTTCTTGACAAGGCTCAGAAGCTTGCTCGCTTTATTAAAGCCCGCCGTGGTTTGTGGTCACGGTTTCGGGAAACGCAGAA
ACAGCTCAAAAAGAAAGGAGAAAAGCGTCGCCGACTCTCTTTAACTGTTGCAACACGATGGTATACTGTAACGGGGTTACACGTACCCGTTAGTGTATCG
TACACGAATAGTGTGTTTCACACAAATGGTGTGCACACCCAAGTTGGTGTGTGTACACGAGACTTAGGTTGGTGGCCTCACAGCCACCCGTCATGCATAT
TACTAGGCTCCACTATGGTAGATAGTGAGTGTTATACATTTACCCCACTGGCGGCCCTGCCGCGAATAACAACAATAAAAATCAGTTCACGTTTTGAAGT
CTAGTGTCTATTAGCCTTATTTAAGGTATTAATAACTCTAGGAGTCTGTAGATCGCATATCTACAGACTGTACTTGGTTCTGGTATAGAACCAAGGTTTA
CAACCGAACTAAGACTCTGAGAGTCTACGTCTTCCTCTGACGCAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCTACACCTGAGT
CTTACGACTGTCCCTCTGTGAGGATGGAGCAATTTGCCCACTTACCCCCGAACCAACAGGACGGGCTTAAAAAGCTGATGTCCTTGTTGGGCCCGGAAGG
TGTGGCTCATCTTGCTTCGCAAGGCCCCGACGCGATTAATGCGCGTCTGGAGGCGTTCTCGAGTTATGAGAATGCTCTGTTGGAACATCTACAACAGAAG
ATGACGGCTGTGACAGCGTCTACGACGCCCAAGCCGGCATCGGATGGAGCTCCACGAGCTAAGCCGCTCATGGTGAGCGTGAAGACCTTTGAGGGCAAGG
AAGGAGAGAATCTCCTGCTCTGGATTAGAGAGGTCGAGATGGCCATGGCGTCCGCCATACTCCAGACGGAGCAACAGCGCGTGGCGCTGGCCGTGTCCAA
GCTGGGTGGCCGGGCCCGGGAGTGGGCCCTAACGTGTGGCACGTCGGTGGACAGCGCGTTCCCATCCTGGGAGCAGCTGAAGCTTCAGCTGTCGCGAGTG
TTCTCGCCGCCTAACCAGGCCTATCGCGTGCGATCACGCTTCCTGGCTACCCGCCAAGGAAAGAAGGAGTTGGTGGACTTCGTCCAAGAGTTACGAACTC
TTATTGCCGGTATGGCTGCGGACCCTCTTCCGGAGGCGGTCACGGTGACCATCTTCATGGAAGGCCTTCGCACTGGCGTGGCCAGAACGGAAGTATTCCG
AGTTCACCCCACCTCTTTTGAAGAGGCAGTGAGCGTGGCGTTGAACGCCGAGTTCAACTTTAAGTCGGCCCGAGCCGGGTGGGGAACGTCGCAGACGAAC
TCATCCGGAGCCGCCGGCTCCTCGGGTGGGCCCGTGCCGATGGATCTCAGCCATGCTGAAGACGAAGATGCTGAGCTTCTTGCTGCCGAGCAGCGCATCG
GCATCCGCCGGTGCTTCGTGTGTGGGAGCACCCAGCACCTGCGACCAGGGTGCCCGCTGCGTAAGCAGCGCCAAGCTCCGGCGAGCCGAAGCCCTGCTTC
TTACCAGAAACCTGGTTCGTGGCGGGAAAACGTCAACGCTCAGTAGGCGCGGGGCGGCCTACTGGGGAAGAACTAAGTTCTGTTGAGCCTCAGCAAGGAG
GTCAGCAAGGCTTAGCCCCGAAGAGCACCGTGCTCTTTAACACGGAACGTGTATGCAAGCCGGGCTTGCTGGTCGTTGAAGCGACCGTGAAGGGCTTTGA
TAAGCCGTGGACGATATTGATCGATTCGGGAGCGTCGGGCAATTATGCTCGACGCTCCACGATGGAAGGAAGTCGGCAGTATGCCGAGGCGCTGGTAGCG
CGTACGAGTGATATTATCACTGTCCGTCTCGCGACGGGAACCCGCGTTACGGTGCCCAAGGTTCCTGTGAACCTTGGCGTGAAGTTTCTGGACTTCGATA
GCGTTGAACGCTGTCTGGTCCTTGACCTGGATTCGAGATATGATCTCATCCTGGGCATGGCATGGCTGGAACGCCATGAGCCATGGATTGATTGGAGGTC
TAAGACCTTAGGCGCTACGCGGTTGCCTCCTGGTGAAGCTTTGGCGAGTCATGAACCCACCTCTGCTAGGAAGCAAAAGCGCTATTGGCGCGAGCACTGG
ACCGAGACGGTCAACGTGCTGGACATCGGCGTGTCGGAGTTGATTGACACTCATGATGTCGTAGACAAGAGTCCCGAAGGGGCTGTACGTGGAGCGGCAC
GTAATCCGCTGAGCGGGACTCGTTGTGATAACGAGCCATCGCTGCAGGCCGCTGATGGCATGGTCGGCAGAAAGCCGAGGCATCGTGGGCATAGCCCTGA
TGATGCGCGTGGAGCGGCACGTTATCCGCTGAGCGGTGAGCGCCGCGATGGCGGAGAATCACTGCGTGCCAACGATGGCGCGGTCGGCCACGAGCCGAGG
CATCCTAGGCCCAGCCCTAACGATGCGTGTGGAGTGGCACATAACCCACTGGGTGGGGACTGCGAGCTATGCAGCTCCTCGCCGGATGTCGAGTTTGACG
TCGACGCTCCGATGAAGCAACAAGAAGTGGAAACACCTGAGGACACCTTTGGTGTGAATATGCAGGCCTCCCCGAGGCGTATGGTCTCCGCGAGGAGACG
GCAGCGACGCCGTGTGGCAGCTGCGAGACGCAAAGCGTCTGTTATGACACAGCAAGTGTCGGGGGTGGTGGATAGCGAACAGCTATATACACTCGTTAAT
GGAGTGACCGGCGAGGTCGCTGGCGACGTCAGCCTTGAGGCTGTTCCCGCCGCAGATGCTCTGCTAGAGCTGGACGAAATGTCAATTGCCGAGTTCGGCG
AGGCCTTAAAGGCGGGCGAATTAGCCGAGGTCGCTTTTATACGACCTGAAGATGAGTTAAACTCGTCGTCCCTTATGGACGAAACAGTCCTGGAGGACAC
GAAGCAGGCGCTTAGTGCGCGTAGTGGATCGGCGATCCTGAAGGATCCTTCAGATCCGTACTATCCCTTGGTTAAGGAATACCAAGATGTCGTTTCCAAC
GATCCGCCTTCTGGCCTACCTCCAGATCGAGGCGTGCGTCATGAGATTGACCTGGTCCCTGGAACCAAATACTGCGTAACAAGGCAGTGGCCCTTGCCAA
GGGAGCAGTGTGACGTCATTGACGCGTTCTTCCGTGCGAAACACGAGGCGGGCATGGTGCGCGAGAGCAAGTCTCCGCACTCGACGCCGACATTCTGTGT
CAGAAAGTCAAACGGCAAGTGGCGCATTGTCCACGCTTTCAATAAGCTCAATGCCGCCACCATTCCGGCGCAGACGCCTATTCCTAGGAAGGATGTTCTC
CAGAACAACATGGTTGGATGCACAGCATACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGTTGCTCATGCGTGCGAGCGACATTCCGCTGACAGCGG
TCAGCACCCCGAGCGGGATGCTCTGGGAGTGGTTGGTGATGCCCCAGGGGCTGTCCAACGCGCCCGCGACGTTCAATCGTCTAGTGACGCAGCTCTTCCG
GCCCCATCGGACGTATGCACAGACATACTTCGACGACATTTTCGTCCACAGTCGTGCCGAGCACGGGAAGTCAGATGTGGACAACCACATAGACCATTTG
CGAGCGGTGCTCGAGTGCATGCGCACTAATAATTTGTACGCTAACGCATCCAAATGCATCTTCGGTGCTGAAGAGATCCCCTTCTTAGGGTGCTTCATCG
GGAAGCGCGGCCTTCGAGCGGATCCCTCTAAGGTCAAAGCCATTGTTGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTTGGCCTCGC
CAACTATTTGCATAAGTACAGCGAGAACTACGCTGATATGGCTCGGCCATTGTCCAATCTCCTTAAGAAGGATGCGGAGTGGGCCTGGGACACCGAGCAT
CAAGTTGCCTTCGAGGCGGTTAAGGAGAGTCTCCTACACGCGCCGATCCTGGCGTTGCCAGACCCCGATCGTCCGTTTAGTGTCGTCTGTGACGCATCGG
ACTTTGCCATCGGTTGTGCACTGCTGCAAGCAGACACTGAAGGGCGTGAACGCGTAATTGCGTTTGAGTCTCGCCAGCTTAAAGCTGCAGAGAAGAACTA
TCCAGTTCATGACAAGGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTTCACCTGCTAGGCTCTAAGCCATTTGTCATCTTTACTGATCAT
GCGTCACTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAGAGGATGGCCCGCTGGCTCTCCTTCTTTGCGGAGTACAACTTCGAGGTGAAGTACAAGC
CTGGCAGGCAGAACGGGTTAGCGGACGCGCTGTCCCGCAGACCCGACTATGAGTTATCTCATGTCACGACTGTGACGTCGTCCGTGACGGACTTGATCCG
CGCTGCGTATGCGCGTGACGACATGTGTGTCGCTCTGCTACGTGCTCTTGGGAGCAAGGAGTTTGGAGACTCGGACTGTAAGCTGTCGGCGCGCTTACGC
GCGAGGCTGCATCGATATTCGCTCGATGATGGCCTGCTGTATTACAGCACCGATCCGGAGGATACTCCACGTATTGTGGTCCCTCACGATGAGGATCTGA
AATATCGTATCCTCTATGAGGCACACGACACTGCGCTTAGTGGCCACCTTGGTCGTGAAAAGACCTATGGCTCTGTGAGCCTCTCCTATTGGTGGCCCAA
GCTTTACAAGTGGACGAGCACGTATGTGCGCACGTGTGAGACGTGTCAGCGGGTGAAGCCCTCACCGCATGCGGCCGCGCCGCTGGCAAGCTTGCCTGTA
CCCTCTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTCGGCCTTCCGAAGGACTCGGATGGCAACACGGGCATCGTGGTCTTTGTCGACCGTTTGA
GCAAGATGGCTCATCTAGCGGCGGTGCCGGACACCATTGATGGTAAAGGTACAGCCAAGCTGTTTATCGACCGGGTTTTCCGCCAGCACGGGCTGCCCGA
GTCGATCGTCTCGGATAGAGACCCCCGTTTCACGGGTAAGTTCTGGTCGTCCGTCTTCAAGGTGCTGGGCACCCGATTGGACATGTCCACAACGGATCAT
CCACAGACCGATGGTCAGACCGAGCGCGTTAATCGCGTCGTGGAGGACGTCCTCCGCAGCGTTTGCGCCGAAACGCCCAAGCGTTGGAGCACCATGCTTC
CACTCGTGGAGTTCGCATTGAATAATGCTGTTCATGCCTCCACAGGCTTTACCCCATTCTACGTGAATGGCCTCACCCACCCTCGCGTCCCGTTGACGCT
ACCACTCCGTGGTTCCGGGCTTGGTGGGGGAGAGATAGCCGGTCGGCTTGCTGATGTCAGCCCTCTCACTGTTCGTAAACAGGTTGACGAGTTTCTGTCA
ACGCGTCTGAGTGTCCTTCGACACGTACGTGACGCTATGGCTGAGAGCCAAAACCAACAAAAGGAAAACGCAGATGCCAGGGGCAGAGGTAACATTGAAA
GTTACGCAGTCGGAGACTTGGTTTTATTAAACGCAAAAAACCTACCTACACATGCAGTTTCTGCGGTATTCAAGACGAAGCTGCGCCCACGCTTCATCGG
ACCTTTCAAAGTCGTGGCCAAGAAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACCCATCCGGTGTTTTATGTGGGCTTGCTCAAGCCG
TACCGGGACCCGGCGCGGGTGAGCGCGGAGGCGCTGGCACCGGGACGTGCACAGGTGGCACAGCCACAGAACCCTGCTGAAGTCGCAGCAGAAGGTCAAC
TTGACCCTCCAGCCTCGCCAGACCTCGCTCAAGGTCGGAGACCCGGTTCGCCAGCGCAGCTGGGGCCTCGAACCAGTCGACGCGCTCCCGGAGCTGATCA
ATCTCGTGCCATGAGCGATCATAGGCGTTCTCGGCCTGATGGAGAGTCTCACGGAGACGTACGACCTCCCGGCGCAGCGATCCCATCGCGTTCCAAGCGA
CATCAAGCTCCGAACGATGCACCCAGTGCAACTCAGCGTCCGCCACCGGCGTTGCTCGATGAGCAGGGCAATCGCCACTTCCATGTGGAACGGATTGTGG
CTCGGCGTCGCCGCCAAAATCAATACCAGTATCTGGTGAAGTGGCGAGGGTACCCCCACTCGCAGAACTCATGGGAGTTT