Transcript Name :
Phyra_g17502
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
PDZ domain10.114PS50106
HmmSmart predictionP-Valprediction_id
PDZ domain0.0028SM00228
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-20
21-43
44-215
NN-scoreoddsWeighted Score
0.7933.1640.006
*** None ***
TypeScore
cytoplasmic47.8
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        711 bases(100 bases per row)
TGCCGGTACGTCCTAGACCATCGGTCCTGCTCTAATAATCCTATTTTTTAACGATGTATGCGTCGGTATCAGGCCGCAGTGGTGGGCGTGGAGCAGGATT
TGCTGATGGGTGTGCGTGTACGCAAGAGCTTCGGCTCGCACGCCTTCTGGGGGACGGTCGTGGGCTGCTACTGGGTCTCGGGCGGCCTGTTCTACAAGGT
GAGCTTCGACGACGGTGACGTGGACATTTTCTCGGCCGATGAGGTCCTGCAGGACGCGCAGCAGGCCAAGACGCACGCCAAGGAGAACGCCAAGGAGAAC
GCGCAAAAGGACCCTGCGTCCAGTGAGACGCCGGTGGACGAGTATCTCACGACTATGCGCCATCACAGCCTGAAGCGCAAGAGGGACGAGCCGGTGGACA
CTTCCGTGCGCAGCGTCCGCCGCGTGCAGCTCTGGGGCCAGCGGCTCTACGCGTCCATCTACACGAATGAGCAGAACGAGACGTTCATCAAGGAGCTCAT
CAAGACGGACAGCGGTCAGATGGGCGAGATGGAGGCCACAGGACAGGTGAAGGTGGGGGACATGATCCTGGCCGTGAACCAGAAGAGGGTCTTGGGCTTA
GAGAGCAAGGACGTGGCCGAGCTCATCAAGAAACCCCAACGACCCATTGTGTTGACGTTATACAGGCCGCAACATTCGCAGTTGCCCGTGCAGCAGCAAC
AGGCAGGACAG