Transcript Name :
Phyra_g11663
Orientation:
(+)
Number of Exons:
4
Description :
POM77273.1 Integrase catalytic core protein [Phytophthora palmivora var. palmivora
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Integrase, catalytic core20.042PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1026
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        3503 bases(100 bases per row)
ATGCCTGACGAGGCCAATGCGGCAAGTTCGAAGGATCGCCAAGGGGACACCACGTCGTACCTCTGGCACCTCCGACTTGGTCACATTGGCCATGGCGGTC
TAGACGCCATCGTCAAGAAGAGCTACGGTGTTGGCATCGACATGACGTCGGTGAAGCAGTGGGAGCTGTGCGACGGGTGTGCACTCGGCAAGCAAACGCG
AGTGAGCTACATGAAGTCGTCCCCGAACCGTGCGAAGCACGTGCTGGAGGTGGTTCACAGCGATGTGTGCGGCCCCATGCAGACGCCAACGTTTGGGGGC
AAGCGCTACTTCGTCACGTTCATCGATGACAAGTCGCACTTCTGCGTCGTGTACTTGCTGAGGAACAAGTCCGAGGTGGCTGCCAAGTTCGCGGAGTTTG
TGGCGTTTGCTGAAACTCAGACCGGCAAGCGCGTGCAGACACTCCGGAGCGACAACGGTGGCGAGTACACTTCCGGCGCGATGGCCAAGTTCTGTGCGGA
CCGCGGTATCGTGCAGAAGTTCACTCCGCCGTACACGCCTCAGCTGAACGGAGTCGCCGAGCGGATGAACCGGACGTTGGTGGAGTGTGGACGCTGCATG
CTGGAACATGCCGGCTTGCCCAAGACGTGAAGCGTTGATGACGGCTACGTTCCTCCGTAATCGGTGTCCGACACGCGCCATCAGCCACGACAAGTCTCCG
CACCAAGTCTGTACGGGCAAGAAGCCGCTGCTGGCGAACCTGAAAGTGTTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCG
ACGCTCGGTCGGTGCGCTGTCGGTTCCTCGGGTACTCGGAGCACGAGAAAGCGTATCGATTCGAAGAGCTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGA
CGCGCAGTTCATGGAAGACGTCTTCGACAGTGGGAGACGTGACTACCATCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCG
TCGCAGTCGGATGAAGACGACAACGAAGAAGAGGAAGAAGAGGAAGCTGCGGCGGGATCGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCA
GTCACTGGAGGAAGTCACGGAGGTTCCAAGTGCCAAGCGGTATGCGTCGCAGAGTCGACACCAGACGCTGGACGAGATGTCGGCTGCGGCTCAAGAAAGT
CAAGACTTCGAAGCTGCGTACGTCGTGAATTCAGTGGGAGAAATGCCGACCACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGG
CGTGCGACTCTAAGTGTGACTCGCTGCTCAAGAACGACACGTGGGATGTCGTACCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCG
CGTGAAGGAGAACCAGCTGGAGAGATTGAGCGGTTCAAGGCGCGACTGGTGGCCAAGGGGTTTTCGCAGAAAGTACGGCATCGACTACGACGAGACCTTC
GCACCAGTGGCCAAGTTCACGTCCATCCGGATCGTACTGAGTCTAGCTGCCAAGTATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCA
ACGGTGTGCTGGACGAAGACATCTACATGGCACAGCCGGATGGCTATGTGGACGAAGACCACCCGGACCACGTGTGCAAGCTCAAGCGGTCGCTGTACGG
ACTGAAGCAGTCGCCGCGCATGTGGAACCAGACCATCGACGACTTCATGCTCAAGCAGGGGTTCAAGAAGTGCGAGTCGGACCACTGCATCTACCTGAAG
CGTGACGGCCAAGACATGATCTTCGTGGCGCTCTACGTCGACGACTTGGTCCTCGCCAGCAGCAGCGACAAGATGCTCCTCGACACCAAGCAGGCGCTCA
GTCACCGCTTCGAGATGATGGACATGGGTCAGCTCAAGTACTTCCTCGGAATGGAGATCGAGCAAGACGTGGTGACTGGGAAGATGTCGATGCGGCAGAC
CAAGTTCGCCAAAGACATCCTGCAGAAGTTCAGCATGGACAAGAGCAACCCTGTCAAGACGCCACAGGATCCGGGTCTCAAGCTGACGAAGGCCATGTGC
GAGGGCGGCTGCAAGCACGACGAGACCATGGTCAACGTGCCATACCGGAACGCGGTGGGATGCCTCATGTACCTCATGGTAGGCACTCGTCCGGACCTGG
CTGCTGCAGTGGGAGTGCTGAGCCAGTTTGCAGCGGACCCGTGCCCGACGCACTGGCAGGCGCTCAAGAGGGTGTTCAGGTACATTCAAGGCACCAAGAC
GCACGGCATCGAATCTCAAGCAAGTTGCAACGATGGACTTCAAGGCTATTCGGATGCGGACTGGGCCGGCGACATCGAGTCTCGACGGAGCACAAGCGGC
TACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAAGCAGCGGACGGTGGCGCTGTCTTCAACGGAGGCCGAGTACATGGCGCTATCAG
AGGCGACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTGCGAGCTCGGCGAGATGACAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCTC
CATCGCGTTGGCCAAGAACCCGCAGTTCCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGCCAAGTGGTG
CTGCAGTATGTTTCGACAACCGACATGCTGGCGGACATGATGACGAAGGCGATCACTGCAGTGCAGTTCAGTGTGCTTCGGAGCAAGCTCGGGATCCAAG
GTGCAATCGCTGTCGAGTCGAGTGGGAGTGTTTGTCAAGAAGGCGCCTCGGGCAGCTGCCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGGG
ACCGCAATCATTCCTGTGTTGACGGGACGCTGATGATGGGACGCTGTTTACGCTACGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATG
GGCATCCACGTGGCAGTCGCTGATTGGCCGAAGCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAATAGGCTTAGAGGTA
GCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCAATTTGCATTTTGCCATCAAGCGACCAAGCCTTTTACGGAGTCGGCAGAACGCGCCATCCGGAC
CATCGTCACGATCGGCCGCAGCATGCTGCATCACGCCAAGTTGGACAAGTGTTTCTGGGCTGAGGCGGCCATGACGGCCATCTACGTGAAGAACCGCCTG
CCGTCACCCAAGGTGGAGCACAAGACTCCATTCGAGATCGTGTACAAGTCCAAGCCAAGTGTGAAGCACATGCGTGTGTTCGGATGCCAGACGTACATCT
TGACGCCGAAGGAAAAGCGGCGCAAGTGGGACCCCAAGGCTCGCGCCGGGTTGTTCCTCGGCTACGAAGAAGTGTCCAAGGCGTATGCGCTTATGTACAT
CTG