Transcript Name :
Phyra_g16151
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1252
NN-scoreoddsWeighted Score
0.5471.4430.003
*** None ***
TypeScore
cytoplasmic43.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        4768 bases(100 bases per row)
ATGGATCGCAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGGAAGATGGCGGGCATCTTCGGGATGGATGCCCTCCAGAGCTTGGCGG
CAGCAACACCTGCCGAGCAGCTCGAGCGCGTAAGCGCTTTCGACACGTACGAGCAAGGGCCAATCGCCCATGTACGTGGGAGCCTACAGGCCCCTGTGGC
TGAACGAAAACCAGTTCAGCCCAAGCCTTTGAGGCTGAAGGTTAACCCCTACGAAGGGAAGGAAGGGGAAAACCTTCACTTCTGGGTCCGAGAGGTCGAG
CTCGCTATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGCGTCGCTTTTGCTCTCTCCCACCTTAGTGGTCGAGCAAAGAGCTGGGCGTATACGCGCG
AAGCGACAACGCCTGGATGCTTTGCATCCTGGGCCCAGCTGTGTGAACAGCTTCGAGCCCCCTTCTTCCCGGCGAACTATGAGTATCGCCAGCGCTCACG
CTTCCTTGCGTGCAAGCAAGGGAGACGTGAGCTGCACGAGTACATCCAGGAGATGCGGGAGCTCACCGCATCTCTGGTGGGAAACCCACTCCATGAACAC
ATCAAGGTGACGGTGTTCATGGACGGCCTGCGAGTAGGCCCAGCGCGCACGCAGCTGTTTCGGGTGCAAGCAAGCACCCTGGAAGAAGCGATTCAAATCG
CTCTTCAGGAGGAGTACAGCCATCGACAGGCTCGCACTCCTGCCACTGCGTGGCTTGGGGGCTCCACTCAGGGCGGGCCCCAAAGTAGAGGCCCCTTCAA
CGGTCCTGTGCCGATGGACCTGAGCCTTGCCGAACAGCACGACATCCGCTGTTTCGGCTGTGGCAAACTGGGGCACATGAAACGTGCGTGCCCCGCGGGA
GGAACAACACGGCGGTTTCCTCCCAAGCCCTTTGGTCCTTGGGGTCGCTGGCAAAAGCCGCGACCCCGTGCCAGGGGAACGCAGGGAACCAGTAGGGGCG
GGGCGCCCTACTGGGGAAGATCTAAGTCTTCATGAGTGGTGCGCGGGTGGTGCGCACCATGAAGGCTTAACCCCTGAGAGTCCCTGTACTCTCGAAGCGG
AGAAGGGCAGCGGAGGGCTGCTTGTAGTACATGCAAGTGTACGGGGATACGATCATCCCATGAGAATCTTAATCGATTCTGGGGCGTCAAAGTACTTTGC
ACGCCGCCGGACGGTCGCTCGCAAGAGCGACCAGTTCTCCGATGCTTTACGAGAAAGTAAAGGGAACGGGCATGTCCTAGTCAGACTGGCTGACGGGACT
GTAGTGGAGGTGCCCAAGGTCTTTATGGACCTGTCCGTCAAGTTTGAGGACTTTAATTCCACTGAACGATTCCTCGTTCTTGATATGGACAAGTACGACT
TGATCCTGGGCATGCCATGGCTTGAGAAGCATGAGCCCTGGATAGACTGGCGCGGCAAAGCCATCGGGGCTAGCCGGTCTGCTGCTACTGACAGAGTATT
GGTGAGTCATGTTCCCACCTCTGTCAGCAGCCGGGCCTACCACCGGAGCCGAGTCGGAAATGACTCCGAAGAATTAGTTACGGCAGGAACCGCAACAGGT
GTCATGACACCGTCCACTGCGGGCAACGGAGCGCCGCAGACAATGCCGGTGGACAGGACGTCGAGTCCAGCGAGGGGAACTGCAATGCCAGCAGTACCCA
CCGCTCCTGACTATGGCACCGTACGGCCTTCGGCCTTATCGACGCCGGGGAAAGTCAACTCCCCAAGGGAAACGAGCCCACGTGAGACCAAGGCGGTCGA
GACCGTGGCCAGGGTCGAGGTTGCTGGGAGCACCTCTAGTGTGGGTAACAATGTGCCACACGGAGTCGATGGAACTCCCGACTCCATCCCTGAGTCACCA
CCGGCTGTGGGTAACAATGGACCATGCCGTGGTGGGCATCGACGACGTCATCGCCGCCGTAAGCCGAGTCTGTTGAGACAGACTGGAGTCGCTACAAGCG
ACTCGGAGAGAGAGAACTCTCCTCAGGCACGGCCGGCCGAAGAATGCTATCACTTCTTCGACGGCGAGACCGGGTGTACGGTCAAGGCGGGCTCCACAAC
GTTGGCAGCCCTGCCTGAGGTGTCAGAGCTACTGAACCTCGAGGAAATGTCGATGGACGATTTCCTGGCACAACTGAAAGCCGAGGCAATCGCGGAGATG
GTGCTCCTGAAGCCGGAGGCCTCTCCAGAAGAGCTGAGCTCCTCTTCCGTTATGGACAAGGATGTCCTGGACGAGCTTGGCAAGAAGCGCGCAACGCGCA
CGGGCTCTGCGATCCTCGAGAACCCCAAGGATCCAGTGTATCCTTTGGTGAAGGAGTTCTCGGACGTGGTGTCCAAGGACCCGCCGTCCCAACTCCCACC
TGACCGAGGAGTTAGGCACGAGATTGATCTCGTGCCAGGCACAAAGTACTGTGTGACCAGGCAATGGCCACTGCCTCGCGAACAGTGCGAGGTCATTGAT
GCCTTCTTCGCCGCGAAGGCAAAGGCAGGCATGGTGCGTGAGTCGAAGTCTCCGCACTCGACGCCCACCTTCTGCGTTCGCAAGCCGAACGGGAAGTGGC
GTCTGGTTCATGCTTATAACAAGCTGAACAGCGCAACGGTGCTCGCCCAGACACCCATTCCCCGCAAGGATGTGTTGTTGAACAACATGGCGGGCTGCGA
GCTTTATAGCGCGCTGGATCTGGTGGATGGATACTACCAGATCCTGATGCGCGAGCGCGACATCCCGCTCACGGCGGTGAGCACCCCGAGCGGCATGCTC
TGGGAGTGGCTAGTGATGCCACAGGGCCTATCAAATGCCCCAGCGACTTTCAATCGCTTGGTCACACAGTTGTTTAGACCCTTGCGTGCGTTCACGCAGA
CGTACTTTGACGATATCTTCGTCCATAGCCGTGCCGGGGAAGGCAAGACGGCTATCGAGGTGCATCTCGAGCACCTCCGTCGAGTGTTTATGGTCATGAG
AGCAAACAAGCTCTATGCCAACATCGACAAGTGCGTCTTTGCGGCACAAGAGATCAAAGTTCTCGGCTGCTTCGTCAGCAGCGTCGGCGTTCGAGCCGAC
CCTGAGAAGGTCAAGGCCATTGCGGCCTGGCCCACACCACGATCCCAAAAGGATCTTCGCAAGTGGTTGGGTCTCGCCAACTACTTGCACAAGTATAGTG
CGGGGTATGCCGGGCTGGCACGACCCCTGTCGGATCTCCTTAAGAAGGATGCCGACTGGCGCTGGGAGAGCCGTCATCAGGATGCATTCAACAGCATCAA
GGCGAGCTTGCAGCGCGCGCCGGTCCTGGCCTTGCCGGACGAGACAAAACCGTTCAGCGTTGTCTGCGACGCCTCCGACTATGCCATCGGTTGCGCGCTG
CTGCAACACGACGCGGACGGGCACGAGCGAGTCATCTCGTTCCAGTCCAGGCAGCTTAAAGCCGCCGAGAGGAACTACCCTGTCCAAGGAGCTCCTCGCA
ATGAAGTATGCCCTTGTCAAGTTCCGGGTACACCTCCTGGGCTCTGAGCCCTTTGTGATCTATACAGACCACGCGTCCTTGCGGACGGTCACCAACTCTC
CGCATCTGTCTCAGAGGATGGCCCGCTGGCTGTCATTCTTCGCGGAATATAACTTCCGCGTCGAATACAAGCCGGGCAAGCTGAACGTGCTTGCCGACGC
GTTATCCCGTCGACCCGACTATGAGCTCGCGCACATTAGTCGGGTTACGACAGATCTGTACGATCGGATACGCCTGGCGTATCGAGATGATGAGAATCTC
TCCCCCATCGTGCGGTTCCTCACCGCTGGCAAGGAGGCCAAGCCTGCATGGCTAACGCCCCGCCACCGTGCCCGACTCCATCGCTATGCGTGGGTCGATG
GCCTCCTCCACTACCGCGTGGATCCGGCCGATCCTCCGCGGATAGTCGTCCCCAACGACGAGGATCTGAAGTATGACATACTTCAGGAGGCGCATGATGT
GCCTTCCAGCGGCCACCTTGGCCGCGAAAAGACCTTCTTGTCAGTCTCCCAGGTCTTCTGGTGGGCCCACATGTACAAGTGGGTCGCCACGTATGTGAAG
ACCTGCGAGACATGCCAGCGTGTGAAACCTGCTGGTCATGCCTCGGCTCCTTTGCAGAGCCTGCCAGTCCCGGAAGACTGCTGGAAGTCGATGAGTCTTG
ACTTCGTCTTCGGACTGCCGGCTGATGCCCAGGGCAACACCGGCGTCCTGGTGTTTGTCTGCCGCTTGAGCAAGATGGTACACCTTGCTCCGGTGGCTGA
CTCAGTCACCGGGGAACAGACTGCACGGCTGTTCCTGGATGGCGTCTTCCGCTATCATGGCCTCCCTGAGACTATTGTCTCTGACCGTGACCCACGGTTC
ACGTCTGCGTTTTGGAAAACGCTGTTCCAATTGCTTGGAACACGGCTGCTCATGTCCACGGCCGACCACCCGCAGACGGACGGCCAGACGGAGCGCGTCA
ATCGCGTCCTCGAAGACACTCTACGCAGTGTCTGTGCCGAATCTCCCGGCACATGGTCGGCCAGTTTGCCGATGGTTGAGTTTGCACTCAACAACGCGGT
ACACGCGTCCACGGGGTTCTCCCCGTTCTACCTCAACGGGCTCCGAAACCCCCTGGTGCCACTCACTCTCCGTGGTGACACCGCGGCTTCGGTCGTAAGT
GGGGGAGAGGCTCGGAAAGCTCTTTCCTCCCAGGTGTCAGAAGTGACACCGGCTTCCCTAAAGAAGTA