Transcript Name :
Phyra_g5751
Orientation:
(-)
Number of Exons:
1
Description :
XP_009518137.1 hypothetical protein PHYSODRAFT_487796 [Phytophthora sojae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-942
*** None ***
PositionContextScore
57SKSRKKR|IP0.744
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2828 bases(100 bases per row)
TGGCAGGGGACGTAGCGTACGTGCAGCTCTCGGGGGCGACGCTGGCGCTGTACGCGGGTATGGAGGCGCAGGAGCTGCAGATGCTGGTGCGTGCGGCGCT
ACAGACGGGTGGGGCCGCGTGCTGCGGCTTCCAAGTGGCCCCAGAAGCGTCAAAAAGCCGCAAGAAGCGGATTCCGCGCCTCGTGCCACTGTCTGTGGCC
TGCAAAGCGCCTGAGCTGCTGACAGGGCGCGTGTCCGCGTTAATGGCGCCGTCAAACGACTCTGGGCGCGCTCTAGGACCTGAGGACGCCGACAAGAGAT
TGCAGAGGCTGCTACAGGCGCTGGAGACGGAGCTGCAGCTGTCCGCGTTTGAAGCGGCCGTGCTGAGGGACGTTTGTGATCAGCAGAGGGACCAGGTGCT
GGCTGTGATGGGCGGGAGGACGTCGGTGGACCAGAAGAAGGATTTTCTGCTGCAGCTGCTACGACCGGAGGACGCTACAGCGAATACTCGCCCAGAGAAG
AAGGACAGAAAGGAGGACACTCGTACAACGAAGAAGGACAGACAGGAGGACACTCTGCAAGCTGAGCTCGTGGCCAAGAAAGTGGTGGCGATTGGCCGCC
GAGTCTTCAGTCCACAGGTTCAGACGCAGGTCTTGGCGCTGGCGGACACCACGAGACACAAGTGGAGCCTTGGAGAAGAGGGCAGCAATGTAGACGAGGG
CAGGTTTGCAGACACGATGCAGCTGCTGAACATGCTGGAGAAGCTGCTGGACAGACACGTGCTGCCGGAGGACCATGGAGCTCACTTGCTGGAGCTCGTG
CTGGGGGGCAACAGGGTGCTGCTCAGTGCCCTGCAGAGCTACAAGAACGACGGAGGCAGTTTGACGGACTTGGAGACCACAGCCAAGAGACTCGCAGCGC
TCGGATGCAACCCGCCTAAGCCTATTGCTAGCAAGAAGAGCAAAGGGAGGCTCACCAGGACGAACGGCTCGCCGGCCAAGAAGAGGATGCGCAATGCTGC
GGCGGCTGTTCCCTCTGCAGTGTCGGTGGTGCGGTCCCTGCACGCGCAGCACATGCTGACGAGTCTGGAGCTGGACATCATACAGGCACTCGTGGCTCAG
GACGACTCGCAGGTGCTCCAGCTTCTGCGGGACTTTGAGCAGAGTGATCACCGCGATGTCAGTGCACTGAGAGATGCGCTCGTGAGCATTGTGGAGGAGA
TTACGATGGAGCTTGGCGACGAGGAGAAGGCTGCTGCTGCCTTTGCACGTGGACTGGATGACGCGGTTCGAGAAGAAAACCAGTGGGAAGACAGCGACGA
CGAGGACGGAAACCCGTTCGGATGGCAGCGACACCTAAGCTTCTTGCTCGGACAATGGCAAGCTCAGCATCATTTGACCCCGACCGATGCCAACACGTTG
CGCAGAATGGTGGCGCAGCAGCACAACTTGTTGGAGAGTGCCTATGAAGTGTTTGCAGGTGACGGTGATGGCACCGAACTCTTGGACACACTCCAGCGTG
TGGCCAAACTGCAGCGACAGATTGAGCAGAGCCAAGCAGGCCAAAACGTCCTGAATGGTGCGCCAGCTAGCGGTCTTAGCCTTGAGGACGTCGTGCGTCA
GATGCAGAGGCGCGGAGTGGTGCAAGCCGGCAATGCGGCAGGTCTATTGGTGCTGTTCCACGGTGGCAACGAGGCCCTGCAAGCTGCCAACGAGGCGTTC
CAGGCAGACGGAGACGTACACGAACTCGAAGAAACGCTGCTTCTCGTGGTCAAACACGCGCGGTTTGGAACAGATGACGAACCTATTGACGAGGGCCAGG
CTGTATCCCGACTTCTAGCGGAGTACGGAAGGTCCGGCCGTCTTGAATTGTGGCAAATCCAGCTACTGATGTGCCTGTTAAAAGCTCACGACCCGCGACT
ATTAGCTGCAGTGGATGTGTACAACGAGGACAAGAATGCTGAAGAACTCATTGAAACGCTCGAGATTTTGGTCGAGCTGGCGGCCTGGGAGCGCCATCGC
CATGCAATCGTGCACGATTGGATCGCCCCGCTGGCACGAGGGGGAAATCTACCTCGCGGTGGAGCTGAACGGCTTCTGCAGCTCGTGAAGGTTCGTGATG
ACCGCGTTGTAGCAGCACTGGTGGTCTACTTGAGTGACGGCAACAAGGAAGAGTTCGTCGATACATTGACACGAATCGCATGCCTCGAAGCGATGAAGCT
GAAGAACGTGATGGCAGACGCCAAACGGAATGAATCGGAGGAGGGGCATTTGGTCTTGGCTCTGCTGGAGGAGCTGGAGGATAAAGGTGTCATGACCGCT
GACGAACGTGAGCACGTGGAAGAGCTGGTATGCAGCGGGGATGCCCGAATGCTGGCGGCAATGGATGTGCTAGCAGCCACGCATGATGCCGAAGACTTTG
CCGACACCGCACGTCGCATCTTGGCCAAGCTAAAGCAAAAGGAAATTGTTGATGAGAGTGTCGAAGCTGAGGTATCTACAGAAGCTGCACCCAGTACTGC
GATGGCTACGGGGGGTGAAGATGAAGCCGCTAAGGGTGTGGAAGCGGACTCTCAGTTCCCGGAAAAGAGTGGCAAAGACGCATCTCCTGTAGCTGAACCC
CAAGAAACCTCTCAGGAGGTAGCGTCTGAGGAAAGCGAGCAAGTCGATGAACAAGAACAGAAGGAAGAGCAAGAGCAGGAAAAGGACGAGGAAATCGTGA
CTGACCAAGTCGAAGAAGATTCTACCGAGGAGGTCGAGAAGGTGGCCGAGGAGGTTGTGGAGGACGCGAAAGACGAGGGTGAAAACGAAGGAAAGGCGAA
CGTAGAGGAAATTGAGCTGGCCCAATAA