Transcript Name :
Phyra_g6499
Orientation:
(-)
Number of Exons:
10
Description :
OWZ02986.1 hypothetical protein PHMEG_00025358 [Phytophthora megakarya
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-31
32-54
55-68
69-91
92-97
98-117
118-120
121-143
144-149
150-172
173-184
185-207
208-213
214-236
237-245
246-268
269-274
275-297
298-300
301-320
321-343
344-366
367-380
381-403
404-409
410-429
430-433
434-456
457-462
463-485
486-494
495-517
518-523
524-546
547-803
NN-scoreoddsWeighted Score
0.7923.5830.007
*** None ***
TypeScore
endoplasmic reticulum77.8
GO
*** None ***
*** None ***
*** None ***
Sequence
        4282 bases(100 bases per row)
TGAGTGTGAAGAAGTCAAGCGAGGCGGCGCCGCTGCTGCCCACGTCGTCCACGGATGCGGTGGCTGCCAAGACGGACGCTGAGCCCAGTCACCACGCACT
GCTGGGCATCACATGCGTGGCGCTGGCGTCGCTGTGCTTCAGCTTCATGTCCACGTTCATCAAGTACATGACCTTCACCTTCTCGTCCATGGAGGCCACG
TTCTGGCGCTCGGTCGGCGTGCTCGTGTGCAACTACGTACGTTGATGGAGCAATCGGAAGCTGCTGAGTTGGTAGTCGGGGCCAACGGTTTGCTCTTCTA
GTAGTGCAGCGACTGACTATATTTGTGGCTGGCGTAGGTTGTCGTGAAGGTGTCGGGGACCAGTCTAGACGTACCGCAGGAATACCGCAAGATGCTGCTG
TACCGCTGCATCGCGGGCTTCGCGTGCATGGGGTTCGCCTTCTACGCCATGTCGCAAATGGTGCTGGCGGACGCAAGCTCGATCGTGTTCACCTCTCCAA
TGCTTACTTTCTTCTTTGTACGTTGCGAGTCTTGGGCTGAGCTGGAGCGCGAATTGTTGCTGGTGCTGACGGTGTTGCGTTCTTGCTTGGTTGGGTTTGG
TTAGGGCGCGCTCTTCCTGCACGAGAAGATTGATCCCGTGAGTCTTCTGTGCGCGTTCGTGGCGTTCGGCGGCCTCATTTGCGTCGTACGGCCGGGCATC
ATCTTTGGCTACAACCACCCCACGGCTGCGACGGACGGGTCGTGGATTGCAGTTTGCTCGGGGTTGCTGGGAGCTGTGAGCCAGGTTTTCGTGTTCCTGA
CCGTGCGCCAGCTGAAGGGGCTCAATGTGTTCGTCATCGTGCACTACTTCGCACTGGCTAGCGTCATTTTGACCATGCTCTGGCTGGCGTTGATTCAGCA
GGTATATTGGCGACTGTCTGACCATTGTAGTGATTCCCAGCTAACGTGCTTGTGGTCCTGTGGCACAGTCCTTCTACATCCCGTCGACGTTCTTGCTGTG
GAGAGCCATCATTGGCACCGGCATCTGCACATTTGGCGGCCAAATGTTCCTGACGCGAGGCTTCCAGCTCGAGAAGGCCGGCGTTGCAGCGGTCATGCGT
TACCTGGACGTGGTCTTCGTCTTTGTCTGGGACTCGATCATTTTGGGCGAGCACATTAACCACTGGAGCATTGTTGGCGCGCTGATCATCCTCTCCTGCG
CGATCGTGATCGCAGTGCGTAAGATACAGGTGACAATGCAAGGCGAAGCGTAGCTTAGCAGGCAACACCCTCTGTCGGTAAAATGGCAGACTCACAATAA
ACTTTGGGTATACATGTCCTCATTGAGTCCTACGGATAGTCTGACTGACGCTGTATCTTGACGCCCGGCTCATCTGGTCGTAGGGAACTTATTTCTTAAC
TTTCGCAGTAAGCGTGAAGGAGAATGCTGGACCAGGACGAGAAGCAGGCCCCGTTGCTGCCCCGTGTCGACCTAGGGCCCAAGGTCGACATAATTCCTCG
ACGCCATTCACTACGAGGACTCGCAAGCGTGGCTGTCTCGGCACTGTGCTTCAGCATCATGACGACGCTCATCAAGTACCAGACGTACTCCATGACGTCG
ATGGAAGCCATTTTCTGGCGCTCCACTGGAGCCTTCGTGTTCAATTCCGTGCGTCGGGTTAACGCGATGGCTGAGCTTTCGCTTAGATGGCTAACACGGT
GTATCTCTTTAGGTGAGCGTGCTGTCTATGGGCAAAAGTCTCTACGTGGCCCCCGACAAGCGCAAAATACTGGCACTTCGATGTCTTGCGGGCTTTTCCT
CCATCGGCTTTGCCTTTTACGCTGTCTCGAAGATGGTGTTGGCAGATGCCAGCGCGATCATCTTCTCGAGTCCCATCATGACGTTCTTCTTTGTAAGTTG
GCGCTGTTTGATACATGCTCATGACGTGATGTTAATCGCTGTACCACGTTCTGAAGAGCGCTTGCATCTTGCATGAGCGGATTGACCCCGTGAGCTTGCT
GTCCGCCATCGTTGCTTTCTCTGGGCTCCTGTTCGTCGTTCGGCCGGGCTTCCTGTTCGGGTACGATCACCCCTCGGACGGCGCGTCTTGGGATGCTGTT
GGGGCAGCCTTATTGGGCGCGCTGGGCCAAGTGTTCGTCTTCATCACTGTCCGCAAACTCCAAGGTGTTCATGCCGTGGTGATCGTACACTACTTTATGT
TGTCCAGCGCCATCGTGGCGCTGGTCTGGGTCCTCGCGATCCAGCAGGTGCGCTACCTAATAGTCTCTCGATATCGAACGCTGACCTTTTCACCAACAAC
TTTGATGCCTTCTACTGCTGGTTACAGACGTTCGTCATCCCCGCAGTCTTCGACGAGTGGAGAGCGATCGTTGGATGTGGTTTTTTCACGTTCCTCGGTC
AAATGTTCCTCACAAAGGGATTCCAACTCGAAAACGCGGGCACCGCCTCCGTCATGCGTTATTTCGACGTCGTGTTTGTCTTTATCTGGGATTCCACCAT
TCTCAAGGAGCACATCAACCACTGGAGTGTTGTCGGTGCAGCAATTATTATCACAAGTGCGGTGGTGATCGCTGTGCGCAAGATGCAGCAGTGAAACTGA
AACCACAGTAGCGCTCTGGGCGGCTGCCGAAATTTTTTTGGTTTTGTGACAATTATTGCAATAAATATTGTGGTTTTCATCCATTTTGGCAAACTTGAGG
TCTATTATCCCGAGATAGGGGGTCTGAAATAGAGATAAGCTCCGAGATAGCAAACGACCAAGTCCGAAATGTAGCAAGGGGGTAGGTTTGTTCTGCTACT
GCATCCCTGTTATAGAGATATCCTTCCGTTTTGCCGCTTTTGAACGGTATAAATGAGTGACATACCTGCTTCTGCCCGACTGCACTGCACCAAGATAGAG
TGATCCATCCTTATAGAAGGCCCGAATTGTAACCCCCCCTTCGCGATGCGGAACTAAAGCAGGCGGCAAAAAGATCGAAAATCACAATAACTACTGCAAT
AGTAATACTTTATTGCGGTTAGATATCAGTTACGAATCGGTTATTTATCTGCAAGATGTGGTGACTTCAATAATGTATTGGGGAGCTTGGCAGCCAGGGG
TTGGTTGGTAACTGAACGGTGTTTTTCAAATAGTGCCTGCATCACTGTTTGAACTCAATTCTCCGCACTTTCAATTCTATTAAGAACCCCCCACTCCCCC
CACTCTACATTTTCCAAGATGTTCACTGCCCGTCGCGCTACCGTTTCCACAATCTTCACCAACCGGCAGGCTTTTGGCTCTAACTTCCGCCCGTGCCGCG
ACCAGTACGACGAGGTGCAATTTTCCTCTTTCGTTTTGCAAGAGCAAGCTAGCGCAACGGTACGCTCGTTATTGTGCATGTTTGTTTGACTGCCGGACTA
ACATCGTTATGTAATTTACATATACCAACTTGAAGCCTGTCTGCATTGAGACGCTTCGTCACGTAATGGAAGCGGTGACGCGCTCAATCGCGGCAGAAAT
GTCTGAGCGGTTCGGCCTCATTATCGACGGACGGATCCACGACTCGGAGCACTTCATCGCGGTGTTCCCGTGGTACGAGACAGACGATGCGGTCCGGAAC
CTTTGCTGCGTTTGATTTCTTGTCAACGATGACGCTAATGACCTGTCAGCAGCCCGTCATTTGCTCTTCTATGAGCTGGTGGAGTTGCTGCCCTCGGTGG
CATCCAAGCGTCGGCTGCGACAACTTCTTGGCGAGCAGAAGGACGTGGAATCAGTATCCAAGGAATTACAAGGAGATAACGTCAACTTGCTTAACTTCCG
CGTATGGTTCGAAGGCCTCATCGCGCTGAAACCCCCCTATGAGCACTACCTCAGTAAGTGTGCATCGATTTTGCTTTATATGTAAGCTGGACCTTTTTTT
ACTTGATTATTGTACGCAGGTCCTCGAGCTGATATTGCGCACAGTCCCAATTTCGAGACTGGATGCATGCAATTGCTACGAGGCCAAGCGAATGACCTGC
GCTGATAAGACTGTACTAGAGCGTTTCCGTGATATTCCGAACGGGATCCAGGAGGCAGGAGAGGATGTCGACTCAGCTTTGTTTGTCGGACGGCTGCAGA
AGCACCAGCGCCCCGAAGAGCAGCAATCCAAGTACGACCTACTGGGATCGATTCCCCCGACGTCGAACGGGGCCGAGCAATTCTTTAGCGTCGCTCGTAC
CACGTTCGGGCCGCAGCGACACTCGCAGCTATCATACACGCTGGGGATGCTGCTGTTTTTGCGTGAAAATGCAGACTTCTGA