Transcript Name :
Phyra_g13381
Orientation:
(+)
Number of Exons:
7
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain1e-30PR00193
Myosin head, motor domain1e-30PR00193
Myosin head, motor domain1e-30PR00193
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site8.316PS50096
Ankyrin repeat-containing domain29.68PS50297
Ankyrin repeat8.763PS50088
Ankyrin repeat10.152PS50088
Ankyrin repeat9.057PS50088
Zinc finger, FYVE-related9.001PS50178
HmmSmart predictionP-Valprediction_id
Myosin head, motor domain0SM00242
Ankyrin repeat89SM00248
Ankyrin repeat3SM00248
Ankyrin repeat14SM00248
Ankyrin repeat380SM00248
Ankyrin repeat0.2SM00248
FYVE zinc finger0.0039SM00064
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
Zinc finger, FYVE-relatedIPR017455
*** None ***
InsideOutsideTMhelix
1-2392
*** None ***
PositionContextScore
199SSNKRKR|AI0.587
888EVERLRR|RA0.538
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
metal ion bindingGO:0046872IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
*** None ***
Sequence
        7965 bases(100 bases per row)
ATGCAGGTTTACGTGCGCGTACAGGACGCTGCCGAGGCCGACTACGAGTGGGTACGCGGCCGCGTGCTGCGACGCCTCGAGCACGACGCCTCCCGCGTGC
TGGTGCAGCTCAACGACAGCGAAGAGACCGTGGAGGCCGACGAAGTCCAAGACGTTCGCACGGCTAACGAGCTCGCGGCGGGCCAGACGCTGGCGGACGT
GGAGAACCTGGACGCTCTCACGCACCTGCACGAACCCGCTTTCGTGGACTATTTGGCGCAGCGCTACGGCGTGGACCAAGTGTACTGCCGATCAGGCGCG
GTGCTCATCGCCGTGAACCCGTTCAAAGAGATCGAGGGTCTCTACAACCTGCAGAAATACCACGATGAGATGCCCGGCTGGACGGCGCTACCCCCACACG
TTTTTTCTATTGCAGAAGGAGCTTATCGGTCGCTGAGGCGACGACTGCACGAGCCTGGAGAGAGCAAGAAGAACCAGACGATCCTCGTGAGCGGCGAGAG
CGGCGCCGGCAAGACAGAGACCACCAAGTTTATCATGAATTATTTAGCAGAGAGCAGTCGGGACTCAGCAGCGACCAGCAGTAATAAGAGGAAGCGGGCG
ATCAGTGGCAGTGAGTTGATGAGCGCGAACCCGATTCTAGAATGTTTCGGCAATGCACGGACGCTGAGGAACGACAACAGTAGTCGATTTGGAAAGTTTG
TACGCATGTTCTTTGATGGACACGAGTTGGATGCGTCCCTGAGGATGGTGGGCACGTCCGTGGAGACGTACCTTTTGGAAAAGGTGCGCGTGGTGCATCA
GAATGACGGCGAGCGGAATTTCCACGTGTTTTATGAACTGCTGGCTGGGGCGGATGATGCTATGAAGAGCGAGCTGCATCTCGTAAACCTCTCAGCGCAG
GAGTTCCAGTACATCAATGGTGGACAATGCTTCCAGCGCAACGACGGCGTGCGTGATGATAAACAGTTCCAGTTGGTGCTCCAGTCGATGAAAGTGCTGG
GGTTCACGGACGTTGAGCGAGGAGCAATCTGGAAAATCTTGAGTGCGCTGCTACATCTTGGAAATGTATTGTTTGTTTCCTCGAGCGAGGATGAGGGAGA
GGACGATAATGGAACGGCGTCAGCACCGTGTCGACTCGCCTCTTCATCACCTTCGTCGCTTACTGTTCAGGAGCATCTTGATATCGTAGCAAGGCTTTTT
GCTGTGGATCAGGAAGAGCTGGTGTCGGCGCTCACGACCCGAAAAATCAGTGTTGGTGGCGAAACTTTCCATTCAAATCTGAGCCTCGCGCAGTGTGGAG
ATGCTCGAGATGCAATGGCTCGCTCATTGTACTCGTTCCTTTTCCAGTTCTTGGTCTCAAAAGTAAATTCAGCCTCGCCACAAGTCGCACCACCTTCAAA
TCCTGCCAATAAAACAACGAACAGGGATGCAGCACCATGTATTGCAGTTCTGGACATCTTCGGCTTCGAAGAATTTGTGATCAATCAGTTCGAACAGTTT
TGCATTAATTACGCGAACGAAAAGCTGCAGTATCAGTTTATCCAGGATATTCTGCTCACGGAACAACAGGCCCATATTGAAGAGGGGATTAAGTGGAACG
CTGTAGACTACGAAGACAACTCATCGTGTCTGGAAATGGTAGAGCAGCGCCCCAGTGGCATTTTCTCGCTCCTGGACGAGGAATGTGTTGTTCCAAAGGG
CAGTGACGTGGGCTTTGCGCGAAAACTCTACCAGCGACTCCAAGAACACAGCAATTTCAGTGCATCACGAACTGAACAGGCCGATTTTGCCTTTCAAATT
CATCATTATGCGGGCAATGTTCGCTATCAAGCCGAAGGTTTTTGCGAGAAAAACAAGGACCAACCCAATGCCGAGCTGTTTAGCGTGCTGGGAAACACGA
GTGATGCTCATTTGCGTGAGCTATTCAATTTTTTCAAAGCAAGCGAGGTGGCACAACTTCAAAATAGCCAGCCGAAACTACGACGGCGATCGTCGGTACT
TAGTGCGGTTGGTATTGGCTCTCAGTTCAAGCAGCAGTTGGCCAGCCTGTTGGATGTTGTGCAGCAAACACAGACGCATTATATCCGGTGTATTAAACCA
AACGACGAGAGTGCAAACAACAAGTTTGATATGGCGAAAGTTTCGAGCCAGCTGCGCTATGGTGGTGTGCTGAAAGCTGTGGAGATTATGCGTCAGTCGT
TTCCAGTTCGTATGAGCCATGCTGATTTTGTGAAGCAGTACCAGCTTCTAGTTGCAACTAGCCAAGAAAACTCTGGCTCGGTGTGGACGGCTCCGGAACT
GATAAAAACCCTGCAGGTTAGCCACGCTGAGCTTGGTAAGACGCGTGTGTTTTTGCGGCAGCAGGCATTTGATCAACTGGAAAAACGACGCGAAAGTGCA
GTCACGGAGTCCGCGGTGAAACTACAGAGTTCGTGGCGTGGTAGACAGCAGCGACGAGGGTACGTTCGACAATTGCAGGTGCTATGGAGTATCCAAGTGC
GGTGGAAGGCTATTCTAGAGAAGAAGCGGCGTCTTGCCCGACGCAACAAGGCGGCGAAGGTGCTTCATCGTGCAATGCGCTGCTGGGTGCAGGTGATTCA
AAACCGGCGGTATCAGAGCGCAATACTCATCCAGCGTGTATTCCGAAGGTGGCACCAAGCACACGTTGCGTCGTTGAGAGCAGCTGCAGCTGATGAAGCT
GCTGCCAAAGCTTCGCGGGAAGAGGATAAGTCTGCGGATCCGCTAGGCTACGGTGGCCGTGAAAGTGAGCTCACTGTCGAAACGTTGGAAGAGGATGACG
TACTGTCAACTGCAACAGCTTCGGTCGGTACGAGTGCGTACTCGGAAGATGTCGAGCTTTCGCCTTTAGATCCAGTGCGGCGAGCTATTCTGCGCGGACG
CATGAACGACTTTGGAAGTGGTTCTGATAGTGAGAATGCAATGCTCAAAAAGGCGCTTAAGGAGGTTGAGCGGCTCCGCCGAAGGGCAGAGGCTGCTGAA
GCTGCTTTGTCGCATTTTTCTGGCCAGGACCTCCGTCCAGAATCTAGTGAGGTTCTGGCCTTGATGACGACTCGAACATCGCCTGCTGATGAACCTGCAG
GTCTTTCCCGTTACACTCGTGGAGCTAGTGGTGACAGCGATTTCTCATGGCGACAACTTAATACGTCGAACCTCAGGATTGATCGATACGGTAACACCGT
GCTCCACCAAGCCGTAGATGGGGGGAACGTGGAGCTCGCGTGCGCGCTTCTTGTAAACGAAACAAGTGGTGCGCTAGAGATGCTACAGCAAGCCGAGACG
CAGCGAGGTTGTTCACCCCTGCATCTGGCTGTTCGTGGTGGCAACTTCGAGATGGTGAGCCTGTTCTTTCGACCGGAGGTGCTGCCACATCTCGACTTGG
ATTTCAGTGACCGTGAGGGCAATACGGCACTGCACCTGGCGACTCAACTTCAGGTGAAATTTGCTTCGCGCGTGCTAGAGCTACTGCTTTGCTTTGGTGC
AGATGCAAATGCAGTGAACTTCCTGAAGCAAACCCCATTGCACCTGTGTGGCATGATCAAGCGCAGCGGTTCTGCAACGTGTGAGCTTATGGAGACGCTC
TTACGTCACAAGGCGGATCCAAAGAAGGTGGACTTCCTGAAACGCTCGCCGCTACACTATTGCATGGAGAAAGGTATGTGTTGATCATTCGCGAGAATAA
TGTCAATCTTTTGCTAACTGGATTGTATACTGTCTGTAGATATGGAGGACGAGGCCGTGCTACTGATGAAGCACGGAGCGGATATGAATTTGCCCGATGG
AGAGGGTTTGCGCGTCGTGACGAACCCCAAGGCTACTGGCGTGAGTACCTTTTGCTGTATATTTGGCGTCGGTCGTAAACTAACCTCTATATTCTATGTA
TGATTGCAGCTCTTGCGTTACCTGCGCGTGACCCCATCATGGATCCCTGACACCGACGTGAACGAGTGCATGGTCTGCCTCGAGCCGTTCCCGTTCTTCT
TCTCGCGCAAGTGCCACTGCGATCGCTGCGGGCGCGTCTGCTGCTCCGACTGCGCGCCGTCCAACTCGTCCTGGAACGGCCGCTTCTGCTTCGACTGCAA
GCACTACGCGCACTACTCGTGAGCGCGCGTATCACGATTATCATCATCAGAAAGAAAAACCAGCGTACCATTAGACCGACAGCGATGCCAAGACACATTG
CATTTTGTATACATGAGGACCAAAAAACATGTTCGAAGCCTTTTTGGACTTGATTGAAGTGCTCAACCCCCAAAATTTGCTCCCGATCCCAAATTTCTGA
ATGTTTTAAAAAAAAAAGATCTGCGGCTCATTTTTCCTTTGGACTTTGCCAAGGGGAATCAGGGACGAAGCTGAAGCGGTCAGCGCCCCCCGACGGACGC
GGCCAGGGCCACGGAGCAGCTCCGAGCAGCAAGCGACGCAAAGCGAACGACGGCGCTATGGAGACCGCACAGCAGCTGGAGAAGGATGCAGGCTTCATGG
ACAAGTACAGTCGCCAGATCGGCGCCTTCGGGCTCGAGACCATGGCCAAAGTGCGCAAATAAGAGCTATTTTTGAAAGAGAGTGATGGTCGCGCGGACTA
AATTTTGTGTATCTTGCAGTTGGTCAAGCTCAAGGTGCTCGTCGTGGGACTGCAGGGCGTGGGCATCGAGTGCGCCAAGAACTTGATCCTCGCCGGCCCG
GGCGCCATCACGCTGCACGACGGTGGGTTACTTTATTTCTTATTTGTGTATACTTGTACTCATTGGAGGGGCCTATTTTTTGTGTAGATGGCATCGCGGA
GATTAAGGACCTGGGTACGAACTTCTTCCTGACGGAGCAGGATGTAGGCCACCCACGGGCCTCCGCTGTCGCGCACAAGCTCGCGGAGCTGAACAAGATG
GTGTCGGTGGCGGTGTACAAGGGCCCGCTCAGTGAGGAGGTGGTGGCCAAGCACAACGTGGTGGTCTTTTCGCACACGAGCCGCAAGGAGCTCGTGCGCT
GGAACCACTTCTGCCGCCAGCAGTCGCCCCAGATCGGCTTCATCGTGTGCGACATCCGTGGTGCCTTTGGCTACGCGTTCACGGACTTTGGAGACGAGTT
CAAGGGCTTTGACGCGACGGGTGAGGCGCCGATCACGCGCATCATCACGGACATTACGAACGACAAGGACGGCATGTTGTCGATTTTGGGCCCTGATGAG
GACGGCAAGATGCACGAGATGCCGGACTCGGACCACGACGGATGGATCGAGATCAGCGACGTGCAGGGCATGAAGCTCAAGGTGGACCCGAACCAGTCCA
TCAACACGATGGGTCCGCGTCGTATTAAGTTTGCTAACAAGAAGGTGTTCCGAAATGGAAAGCAGGCGGAAGTCTTCGACGCGTACCGTCTGAAGATCGG
TGATACGTCGGAGTTTACGCCGTACGAAGGTGGAGGCGTCTTCACTCAGCATAAGAAACCATTTACGGTGAACTTCAAGTCGCTGGAGGAATCGCTGGTG
GCGCCGGTGCCTGCCGGGGACTTTGGACTTATGTTCACCGATGGAGCCAAGTTTGGCCGTGCGGAGCAGCTTCACATTATTACGTGGAGTCTTATGGAGT
TCGAGGAGCGTCACGGCCACTATCCGGAGCCGCACAACGACGCGGATGCGGATGAAGTGGTGGCTATTGCCAAACTGGGTATTCAACATTTCTCGGATTT
CACTCGTGAGGGTGCTAACAAGCAGGAGATTATGCAGCTCGAGGAACTGGATGAGAAGTTGGTGCGCCAGGCGGCTCTGTATGCTGCTGTTGAGCTGCAC
CCTCTTGCCGCGTTCTATGGTGGCGTTATTGCCCAAGAAATCGTCAAGTTCACGGGCAAGTTCACACCGCTGAAGCAATGGCTACACTTGGATGCGTTCG
AGGTACTGCCTGATGAGCGCCCGATCGACACGCAGCCGATCGGCTCGCGCTACGACCATATGATCATGGCTTTCGGTCTGTCGTTTCAGCAGCAGCTAGG
CAACGTTCGCACATTCCTTGTGGGGTGCGGTGCGCTTGGGTGCGAATACCTGAAGAATTTCGCTATGATTGGTATTGCGTGCGGTGAAAAGGGTCTTGTG
ACGGTCACAGATAATGACCGAATTGAAGTGAGTAACTTGAACCGTCAATTCCTCTTCCGGGAGCACAATGTGGGTCAACCCAAGTCCGTGGCTGCGACCG
CTGCCGTGCATCAGATGAACGCGGATCTGAAGGTTAAGACTCTCGAACAGTTGGTGGCCCCGCACACGGAAAATGTCTTCAACGACGATTTCTGGACTGA
CCTGGACGTGGTCACTAACGCCTTGGATAACGTGAAGGCGCGTCTGTACGTGGACGGCAAGTGCGTCTTCCACAAGCTGCCCCTGTTGGAGAGCGGGACG
CTAGGCACGAAGTGTAACGTGCAAGTGGTGATCCCGTACAAAACCCAAAGCTATGCGGATGGCCCTAAGGACGCGGAGGGTGACGGCATCCCGATGTGCA
CGCTGCGAAACTTCCCGTCTCTTATTGAGCACTGCATTGAGTGGGCACGCGCGCAGTTCGAGGATCTCTTTGTGGTGCCTTCCGCCGAGGCGAAGAAGTT
CGTGGAAGACCGCGCAGCCTATCTGGATCAAGTGAAGAAGACTACTTTGGAAAACCCGAACCCGAAGCTTGTTTCTGCAGCCATTGTCCAGGAACTTGAG
CGTCTCCGAGGTCTGCGCGCCACGTTGCAAATCGCGAAGGGTATCACGTTTGACAAGTGCGTGACACTGGCGTTTGAGCTCATGACGTCGTGCTTCCGTG
ACCGTATTCTGCAGCTGATCCACAACTTCCCGGAGGACCACCTGACAAACTCGGGCGAAAAGTTCTGGTCTGGCGCCAAGCGTTTCCCTCAAGCAGCGGA
GAGTTTCGACCCGGAGAACCCGCTGCACCTCAACTTCGTGCGCGCCACTGCCAATATATTGGCTGTTTGCTACGGTATCCAGCCGCCACCTGAGCAGAAG
CTGGTTCCTGCTGATTCCAAGTGGCGTGAGCAGTCCACGTATGAGGAGCTCGGCAGCAAGTATGTTCCGCCGACGTGGAAGCCATCAAACGAGAAGATTG
CAGCGGACTCGGACGAAATCAAGCGCCTGGAGCAGGAGAAGATCAAGAACTCGAACGATTCTGACAAGAATGAGCTCGTGGCTTTACTTGACGAGCTTGA
GACGTTTGACCTCTCGGGTGCCTCGTTCGAGCCAGCGGACTTTGAAAAGGACCAGGACATGAATTTCCACATCGACTTCATCTACGCGGCGTCGAACTTG
CGGGCCTTTAACTACCGCATCCACGACGCATCGCGCCACAAATGCAAGATGATTGCAGGCAAAATCATTCCGGCCATTGCGACGACGACAGCATCCGTGA
CGGGTCTGGCAATGCTGGAGATGCTTAAGCTGGTCCAGCGCAAGGAGCTGGAGGCGTTCAAGGACTCGTCCAATTCTCTAGGTCTGAACATGTACCTGAT
GCAAGAGCCAGCGGAGCCCGCTCGTGCCAAGGACGAATACGACGTGGTGGAAATGTCGGAGGTTAAGTGTAAGCCGCCTGGGTTCACGAAGTGGGATTCG
ACGCTCGTCGAGTTTTCATCTGCTTCGACTCTGGAGGACTTCTTGACTCAGTTCAAGGAAAAGACAGAGCTGAACTGCGACTTGCTGTTCCACCGTGTCG
CCGAAATGGGAAGCACTGGCGCGGCAGATAAGGATCTGCGCTACCGCACCGTCAGCGGTCTGATGCTGTACGACCGCAACGCCTACGGCAAGGCGCTGAA
GGAGCTGTACGCTGAACAGATGACGAAGCCTCTGCGAGCCTTCGTGGAATCGCGCTATGAAGGACTCGTGGACTGCAGCCGCAAGTACATTGAGCTGCAG
ACGTCGTGCTCCGATGACGACGGAAACGTGTTCAGGGTGCCGACAGTCATTTGCAAGTTCAGCTG