Transcript Name :
Phyra_g2477
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-159
NN-scoreoddsWeighted Score
0.5462.2120.004
*** None ***
TypeScore
cytoplasmic78.3
GO
*** None ***
*** None ***
*** None ***
Sequence
        889 bases(100 bases per row)
TGCATCACTACCGGTTGTGGGTAACGAAGGACCACACCGTGGTGGGGATCGACGACGTCATCGCCGCTGTAAGCCGAGTCTGTTGAAACAGGCTGGAGTC
GGTACAAGCAAATAGGAGAGAGAGAGATCTCCTCAGGCACCGCCGGCTGAAAAATGCTATCACTTCTTCGACGGCGAGACCGGGTGTAAGGTCAAGGCGG
GCTCCGCTACGTTGGCAGACCTGCCTGAGGTGTCGGAGCTTTTGAACATCAAAGAGATGTCGATGGACGATTTCCTGGCACAATTGAAGGCCGGGGCAAT
CGCGGAGATGGTGCTCCTGAAGCCGGAGGTCTCTCCAGAAGAGTTGAACTCCTCTTCGGTTATGAACGAGAACGTCCTGGACGAACTCCGCAAGAAGTGC
GCGACACGCGTGGGCTCTGCAATCCTCAAGAGCCCCAATAATTTAGTGTATCCGTTGATGAAGGGTTTATCGGACGTAGGGTCCAAGGATCCGCCGTCCC
AACTCCCACCTGACCGTGGATTTAGGCACAAAGTAATGTGTGGTGTGACCAGACAATGGTCACTGCCTCGCGAACAGTGCAAGGTCGTTGATGTCTTCTT
CGCGCGAAAGCAAAGGCAGGCATAGTGCGTGAGTCGAAGTCTCCGCACTCGACGCCCACCTTCTGCCTTCGCAAGCCGAACGGGAAGTGACGTCTGGTTC
ATGCTTATAACAAGCTGAGCAGCCCGCTCAGACACTCATCCCTCGCAAGGAAGTGTTGTTGACAACATGGCGGACTGCGAGCTTTATAGTGCGCTGGATC
TGGTGGATGGGTACTACCGGATCCTGATGCTCGAGCGCGACATCCCGTTCACAGCGGTGAGCATCCCGAGCGACATGCTCTGGAAATAG