Transcript Name :
Phyra_g2459
Orientation:
(-)
Number of Exons:
7
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1100
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        7342 bases(100 bases per row)
TGCGAGCGTCCATGAGGTTCGTAGTCGCTTCCGCCGTCGCACTTTTCACCGTCTCGGAGTCCGCCGCCGCCGTCACCGCCGACCACCGCGCTCTGAAGGC
TTCTCTCTCCGAAGTCCCCGCCGTCAAACTCCATGTTTCGCTCAAGCGCAAGGCCATGGAGATCCACGGACAATCCGAGTTCGACGTGTTCGCCAACCCC
GTCGTGTCGTCCAACGGCGCCAGGGTCCTCTACGACGGGTACGCCACTTTTCTCGATGAAGGTTCTCAGTTCACGTACTCGCTGTGTGAATGGCGCCGCG
TATTTGGCGACAAACGAAAGCTCGTCAACTGCCCAGACTTCCGAAACAGTTCGATGTCTCCCCCCTCAGTACGCTACCATTCAGCTCTATTCTGCCTGCG
CTGAACGATGTCGAGCCGATTCCAAGCGCGTCTATCGGCGACGTTGAGGTCGAGTGCGAGAGTGGAAACTTGTTCAAACGACGTTTGCTGGCATCCACTA
CGCAATCTGCGCGGCGGGGCGAAGATGGATTTACTGCCTTCAGCAGTGACTTGACAATCGACGTCGAGTACCTGAAGAACCCAGTCAGCATTTTGGCCCC
AAAGCTGAGCGATGGGTCGCGTGTGATGCAGTAGCTACCCCCACGCCGTCACTCCGAGTGCTTTGGCGCTGATGACAGGAAGTGCCATTCCAAAAAGTAC
GTCAAGAAACCTGAGGGAGGCGGCACACTTGGCCTTGGAAGCTTCGTCGTGCGCGTGCAACTCGACACCTCGCCGTGCATCTTCTTTCATGGTCTTGGCA
ACGAAAATGACGAGCCGGGGCTTGTGGACTCCATTCGCCACTTTGGCTGGGATAAAATTCAAGGTCACGCTCCTTGCTGCACAACGATCAAGTACGCTGC
GCTGAACACGATCGATTACGGATGGACGAACTCCTCCTTGCAGCAGAAGGTGTGTGATCGCGCGCTAATGGCGACGAATTCTGCCGACTCGCCACGCGGT
CAATAGAAACACCATTGTTGTGACGCACTCGATGGGTGGACTGATGTTGCTGCCGCGCTTTGCCAACAAAGAGTGCACTCTTGATCCAAGCTCCACGTGG
ATAGCACTGAGCCCGCCCATGACTGGCAGTATGTCTTCCGACTACCTCATGGATTTCTGCAAAGGTGAAATCGACGGCTTTATGACGGATCTACTCTTCA
TTGGTAGATGCCCAGCTTCCGCGGCTACGAAGTCCGTCGTCTACAAGAACGAAAAGTACAGCACGGCGAGTCTTGATGCAGCCTACGATGCGGCCTCGGC
AGTCTATCGCGAGAAAGTGTATGCTGCGATGTGCAGTAGCTCCTACATCGGAAACATCTCCAAGTATCAAGCAAAGTATATGCTTGGAGGCAGCACGATC
CCGCACAAGTCCTCCAAGAACGACGGCCTTGTTGAATTCCATAGTTGTGCAGGTGGAATGTCACCAAGCAAGTTCGGACGAACCCCCCGGGACAAGTTTT
ACAAGTGTGAATTGAACCATGCAGACACGGCATTCAAAACGGGAGATGGTATTTTCAAGTCCACCGTAAGGCCCGTGACATGGTTCGAGTGCCTGCTGTA
AGTAGACAGTGCTGCCAAAGAAATACAATTTTCAATTTCGTAATTCTCATTAGCAGAGTAGGTGCACAGTACACCCTTCACGTTATTTAGTCGACCCCTG
ACTAATTATGGTTTACGTGAAGAAATCTGAGCTTTTGGTTAGCTGTTGTGACCTCAATATTTGGGCACGACTAAGTAGCGCGAAGGGTATATTGAACTGC
CAAAGTCATCTCACACATCTATTTCTCGCTCTGACAAGCTTTCGTTGCATGTCATCAATTTATTGGTTCGCGGGCACACTTGATTTCGCAGTTCGGAGTT
TTGTATTTTTTGTTTTCCGGTTTAATGCTCAGAAAGAATGTTGCTGGAAAGTCGACTGAATTGAATGTTTCGTGAATGTTGTTTGATGACAATTCGCCAC
CGAAATATCGTTTTATTGGTTTGCGGGTTAAAACCAAATAGTTTTCTGGGTAAAATCAAACACGTTTTGACCACTACCAAACACACAGAGTCTCAAGCAA
AAAAAAAAACGCTGAGAACGAGTTGGTCCTGAAACAATAATCGGGCAGGATCAAAATTGGCATCTCAGTCGAAGTGTGGTCCACTGTTCCTTAGGGTTTT
AACCTAACCTACCGTCTTACCCCGCATAGAGTGTCTAGGCGTAATAATAAAAAATCGATGTGCTCAAAATCAATATAAAGCCCCGATCACAACACGTATC
GGAATAGAAGGACGCCCACAGAGGAAAGGGTTCTTTTAAACGAGGTCTGAACCAAGGCTTCTAGGTTGACTCTAACAAATGGCTAGACCACCTACTCTCC
AACCATTCTTCTCTACCGGTGGCCATCGACGTTGCATGTACTCATAAGCTCATTAACAAAAACACTCGTTACCAGCAACACCTTCACCAGAAGCTTTCCA
GTGCACGATGCCCAGCTCACGACGCAGCTTCACAATAACAGAGAAGCTCTCAATTCTTGATGAATATGAGCCCGGTGTTCAAGGGAAGGGTTTTCATGCT
CTTGATCGTCAACACGGTGTTTTGTCTAGCACCATTCGAGGCTGGTAGGCGAAACGAATTGAGCTGGAGAAGGCTTCGCGCGATCGACGAATTACCACAC
GAACGGCCCGACGCCTCAACGGTGGTGGGCGACGACCAGCTCACAGTGACATGGAGGAGTTGCTTTACGAGCGGGTCACCCACCGGAACAGCAAAGGCCT
GCGTGTGAAAGACTCGTACATTCGGCTGCATGCGGTCAACATCTATCGCGAACTCCACGGCGGCAATGCAGCTGGCTTCGAGGCCTCGTCGGATTGGTTA
GCGAGATTCAAGAGACGTCGGAACTTGGTGTCACGCAGACAGACAACAACCCGGACTCTACCAGCTGATGCACCTGACGTTTGTCAGCGTTTCATCCAGC
AAGCCCAACACCTCATCGCCAAGCATGGAATCAAGCCCAAAAACATCATCAATATGAACCAGGTCCCTCGCTACTTCGAGACTGAGCCCAAATCAACGAT
AACTACCCGCGGCGTTCGTGAGGTTCTGCTGCGAAAGGGCGGCTCAAGCCACAAGTGTTTCACAGCGACGTTTACTACCACAGTGGAGGGCGAGTTTCTG
ACGCCACACCTGCTCTTCTCCAAGCTGAAAAACAAGCCCAAGTGTCCTGCTGGTGTTCTTGTGGATGTCAACAAGACCGGCATGTGGAATGAAGACCTCC
TCCTGGCTCATGCACAGACAGTGGTTTGCGGAAGGAAGGAGACGCAGCTCTACCGAGAGCCCGTCCTCTATCTGATTGATTCCTATGGATGCCACGTGAA
ACTGGCGGACTCAAAGCGACTGGAACGCTATAACGTCTTCGTTCTCTTGGCCCCACCCAATCTCACCAACCTGCTCCAGCCACTGGACGTCGCTGTCAAC
AGGAGCTACCAGGAATTCTATCGGTCAAAGTTCGATGAGTACATCAGCTTGGCCCTCCAAGACAAGAGCCTCCAGACCAAAGCCGGCAACCCAAGGTTCT
CCGTTCCGACACTGTGGCCCAGTGGACCCTTGATTGGGAGCTCCAAATCGGCAGCCGACGTCAAGAAGGTTTTCTCTCTTTGTGGCTTGGTAGCCAAAGA
AAACTTTCAGGTGGATCAACTACACGCTCCGCTAAAAGATATCCTGAGCACCGACTTCGACGTGAGGAAGTGGCATGCTTCGTATAAGCACCTTGTCACG
GAAGAAGCCGAGCGAGAGCTGGTGCGAGTCTCTGCTCCAGACTGGTACATCCCAGAAAAGGAGAGAAGCACCCTCTTCTGTTGTCTATCGTACGATTCTG
ACGTGCTGCCTCACGAGTACGCATCTGCCTTAACCAATTACATGGCTACGCTGGACGACCTGCTTGGACTACTGGATGAAGAGTACCTCGTGTGGCGAAG
CGGGATCACGAAAATTGCTGTCGTGATCTCCGGCTTACCAGCGGTACGCCCGGACTGCCGACTATCGGAGGGGGTACTCCGTTGATCTGGCGCGATCGGA
ACCTTGTATTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCACTGAAGGCGTCGGTGGTTACCAGGATGGGGTGGGGAGCTGGA
CGGCTCCTTCCGGGGAACTGGGGGTTGACGGCCACGCGGGTATTCTTCACGTGGTCGTCGGTCGTCTGCCGATCGGGGCCTGGTGGGGCTTGATCGGCGT
GGGGGGTGTCCTTGGGTGTGTTCCTTTACGTGCTTGCCGCCTCCTATGGCGGGGTCTTCTGGGGGGGGTTAAGTGGTTGCGCACCTGGCCAAGCGATCCA
GGGGCTCCCGTGTAAATTACCTTGCGCGACGAGGTGAGTCCGAAGTCGTCAGGAGGGCCAATATACTTCCCAGCCTGGAATAAACGAACGCCACTCGTGT
TGCAAGGGAAAGCTTCTTCTTCTCTTATTAGGTAAAACAAACAAGCAAAAGCAACAATGACCTCAGCTTCCTACCCCCCCCCTTTACTGGATTCTTTCAC
CCATCTCCCGAGGTACCTTCCACAGATCTTCTACTCCGGAATGATTGCGGACGTACCACCAAAGTGGTACGTCACGATCGCCATCTGCGATCAGGATCGC
GATCGCAGTGGTGGCCACGATCGCATATCGAAATGATCGCACCATACCGCATACCGGTATACACCGATGACTGATGGCGCCACTGTACCCATTGGGTCTC
CATACCCCTACCCCTCAGGTCCAATTTAATCCCTCCAAAGTCTGCCTTCATCAACCTCCGATCGTACGTCCGGTCCCGTCCGATCCTAGCCCATCGTTGG
TCCATCACGAAATTTCCAACATCCACTTCACCACAATCGCCCCCTGTACATGCCGGGGCTGCCCAACAGTCTTGGCGTGCACACTCGTCACTTCTTCTTA
TCGCTCCTCGCCACCACACCTCCACAGCACCATGTCGGACAACTCTTCGCCGGATCAGAGGCGTTCCCCGAACGATCCTTCTTCCCACTCGCCTACGCCC
GCCTCTTCCCGATCTCCTTCGTCGCCGCAGAGGGCTACGACCTCGAATTCGTCCACCGCTGTTCCTGTGGCTTCCGATGCCACCGTCACAACTCCTGCAG
CTTTCTCCGAACATGTACGCCGAATCGAAGGTCAACCTGGCGATCTCTCGACCGAGTCGTTGCCTCAAGCTGGTTCCTCGTTGCCGCCCTTAGACCAGAT
CACTATCCGGAGATCGTTGGCTGCAGTTGAAGCCGCTCTGGATCGCGAGAGTGAGTTTCAGGCACTCCAGCGCAGCTACAACGACTTGTTGCAGTCCTAC
TTCGCCTTGCGACAACGTGTGGCAGACCTGGAGCACACAATTCGGTCGGCTCAATCACCGTCCCCATTCGTCTGCCTCGTCCAGCAGAAGTACGGTCAGC
TGTCCCATCGTCTCGCGCAGTCTATCCTGGACTTAGCGGAAACCCGAGAAGCTCTGGCCCGGAGACTCGACAATGCAACCGAGCTCACCAACCTCCGTGA
TCGTATGCGCCTCCAAGATCACGTACACGCGGAAGCCGTCGCTGACTTCCAAAGGGAAATCGATGATTTGGAGCGGCGTCTAACGGCTGCATTGGCAGTT
GCCAGCACGACTTCTGGTGACACAGCTCTGCCTCCGCCTGGGGTCAACCCGACCACCCTCCAACTCCAATCCCAGCTGAACGTGGCGATCGCAGCCCAAG
GTCTAGCGAACCGTGATCTGGATCAGGCCCGCGACTCAATTCGCGATCTCGAGACCTCCCAGAAGGCTCTCGAGGGATCGGCGCAGATCCTCCGGCAACA
GGTGGCGCTACTCGAGCGTCGTGCGTCCGAATTGCGCGACCAGTTGGCGCAAGCCCGACACGGTTCCCGGCGTGCCCTCGACCAGAGTCTTCAGGAACGA
CAACGGCTGCAGGACCTACTGGACAAGTCCGACCAAGATCTAAGCGATCAAGCGGCGAAACTACAACGGGTGACCCAAGAACGTGATCGCGCTCGGAACG
AGCTTTCACAAGCACGTACGTAATCGCGTCGATACTTCAGCGTCCGTTGATCTAATCCCGTTTCTCTTTCTTGCAGGTAACCAAGTCACATCCGCCCGCC
TTTCCATAGCTCGACTGGAGCAGCGAGCAAGCAGCCTCCAGTCTTCGGTAGCCGCCAACCACCAGCTGAGCAGCACTAATGCCGTGTTGCGTGCTGACCT
CGCGACCGCCCGTCAATCCCAACAAGATCTGGAGAGCGTGCGTGATCAGCTGATCACAGAGCGAGACGGTGCTTTGCGGCGCCTTTCGGACATCACCAGC
ATACTTCAACCTGGCTCGATCGTTCCTCCGGCGACTCCTGTTCCCACGCCAGCCAGCGATCCCTCCCTGCTGAAAAAGGTTCCATCACGGAAACGTCTCG
CCAGCCGCTCTCCTTCCCGTCGCTCTCCATCAAGTCCGTCGTCTCGTCGCAAGCGGCCTCACAAGTCTCGACGTCGCCGATCTCCTTCATCCGGCGACAG
CGACGATGATGACGCTCTGAACGCCGGTCTCGCTCGATCGCGTTCTTCTAGTAGACGATCACATTTGTCCCGATCGAAGCGTCGCGCAGCAGGTACTCCC
AGCAAGCCGATCAACGTCGACTCTTCTAGCGATCGTGGATCGGATGGCCAAGCCAGCGACGACGGCAATAACGACGATGGCGGTAACACCGGTGACGATG
ACCGCGATAACGACGATGGCGGTAACGCCGGTGACGGCGACCACAATGACGACGGTAACGACGGCGATGACGACGGTGATGATGACGATAACGACGGCGA
CGGCGACCACAATGATGGCGGTAACGACGGCGATAATAAAGACAGCGACCACGAGGGCGACAACGACGATGACGGCGGCGGTGACGGCGGCGGTGATGGC
GGTGACTCGTCCGGAGGCAGCTCCGCCGGCGACCACCACTCGGGCGATTCCGATAGCAGCGATTCAGCGAACTCTGTCTTGTCCGATGCCGAGCTCGATC
AGCTCGATCCCACCACCATCTCTCGGGACCGTTGGATCCCAGGGTACCGGAGTCCTGTAAGGTTTGCGGGGTACGGACGTGGACCCTTGGCCTCTTTCTC
CGGTTCGTCAACTCAGCGTCCGCCATTTGACGGTCGCCACGTTATTTCGTCAGTGGAGTCGTCCGCCATCTTGGCTATTCCCGCGTCGGACCCGCACTCC
TTCTGCTGGCACCTGGAATCCCGACTTGATCACCCAGGCTAA