Transcript Name :
Phyra_g2059
Orientation:
(-)
Number of Exons:
11
Description :
ETO71634.1 hypothetical protein F444_12050 [Phytophthora parasitica P1976
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Bromodomain0.000000000048PR00503
Bromodomain0.000000000048PR00503
Bromodomain0.000000000048PR00503
Bromodomain0.000000000048PR00503
Profile scan predictionP-Valprediction_id
Bromodomain17.494PS50014
HmmSmart predictionP-Valprediction_id
Bromodomain3.5e-27SM00297
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2645
*** None ***
PositionContextScore
101NMARKFR|GV0.547
147VHNRWKR|DS0.713
324EVGRPKR|EA0.696
360INQRDRR|PS0.583
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        10374 bases(100 bases per row)
TGCCGATGCCTGCGGACCTCCATGCCAAGTGCGCGCGCCTGCACGCGGACCTGTCGCGCCACTTGCTGGCGTGGCCGTTCCTGGCGCCCGTGGACCCCGT
GGCGCTCAACGTGCCCACGTACTTCGACGTGATCGCGCACCCCATGGATCTCAGCACAATGGGCGCCAAGCTCAACGGCGGCGAATACCGCGACCCCGCC
GAGTACCGCGCCGACCTGCTGCTCATGTTCGCGAACGCCGTCGAGTTCAACCAGGACGACGAGCGCGAGGACTCGGTGGCCAACATGGCGCGCAAGTTCC
GCGGTGTGGCGCTGGCCCAGTGGGACCGCTTCTTCTCGGAGGCGGCCACGGCCGACTGGGCGCAGCAAGCAGAGCTGCAGCTGCAGCAGCGCTTCGTGCA
GCGCGCCAAGGAGAGCCGCGTTCACAACCGGTGGAAACGGGACTCATTCGTGGCCAGACTCAACCGAGACAAGTTGGACGAGCGCACACGCCTCGCAGCG
TCCAGTGCCGAGTAGTTAGGTCTAGCTTTTGAGAACAATTTCTTTAGTTTTTAGGATGGATGATGCATATTTGCATGTTTCTCGGAGAGTCGTCCGTTAT
CTTTTTTTCTTTTTGCCGTGGAGCAGTTTAGCTTTTGTTTTCGGGATGGAGGGGCGACGTCATGTGGCCAAGGGCAGTCGATCGAGACCGCCGCAGCTCC
CGGGCAACTCGATTTATGACCTGACGCTGGACGCGACGTTCGAGTTTGATGGTGGGTCGGGATTCGGAGCCACGTTGCCGTCCAACACACCCATGAAGGC
GGTGCCTGGAGCACGGGCAGCAATGAAGTCGCCCATGACGGTGGGAGTGGATTCGGCTGCGAGCCAGAAGTTCACGTTCACTACTGCAGAGGAATACACG
TCGCCAAAGAAGATCCCAGTGTTTCCGGGGACGCTGCATAGCCCGGAACGCAAGCACAAGCCGCATCGAGCCAAACCTCCACCTGGACACGCAGCAAAAG
AGGCGCAAGTGGCTTCACCTGGGGCTAAAGCAGCGAGCGATGCGTTTCCTGCGCCAACTGGAGTTTCGTGGGAAGGCGAGGTTGGACGACCGAAGCGGGA
GGCTTCGCCTCGGCGTTTTCTCCGCACTACACTTGCTCGGTCGTATGGCGAGCAAGGAGGCGAAGAAGATGAAGAAAAGGCTGCTATCAACCAGCGGGAT
CGGCGTCCGTCAGAGTTCATAGGCCATCATGACCCGGTAACTGGGACGTCTAGCGTGATCGTAGCAGACGCAGCTGCTGAAGCGGCGGCAGCATCAGCGA
CAGCTTTTCTTAAGACAGGCGAGGATACTATCGCCTTCTTTGCGCGCAATGGATCGGATAGCGAGATCAAGTTTGTGCATTAAATCGCGCGGAAACTGGG
TTAACGTTCCGACCGTATGATCTTGTGGTCGTTGCACAGGACGACGTGACTCCGAATGAGCACTTTACGATGTCGTCTAGCGGACTTGTGCACGTTAGCA
CTGGCAGTCCCTCCGAGTTCATTGCGCTGGCGGAGTGGATGCGTCAGTCTACGATGTTCAACGTGCTTACGTCGTTACGCTTCTTTAAGCACTACCTCGT
AAACAAGGCGTTTTCACTTTGGTGTGCCAACGTGCGCTATAAGCTTTACTGCCGCCAACGCAAGCGGCTGAGCACGAAATTGTTTTTGGCGAAGGAAAGC
TTTTGTGTTCCTTTGCTACAGGTAAAGAAGGTGATGAGCACTGAGCTGATGGGTGTTGTTTTGCTGGATCTGCGCGCTCAAAAGACGTACGAAAGCTCGG
CTTTTGTGGAGTACCAGGGCACTAAACGTGCTGAAGGCTCGAAGCAGTTTGAGGTATGCATTGAGAAATTGCAGTCGATCATTCAGCGTGTCTGCTCCGA
TGTGAAAAATTTGACGAAATCGTCAAACCCACAAGAGGATTTTATGTCCGATATGTCACTGGGGGCAATGGGAACCAGTCAGGAAAAGACCAAGTCGATT
GTAGCTGTCAAGGCGGAGCAACAACGACGACGGAGACTCTTTCGCCGAGCCGCTGAGGAGGCAGGCATGATTGCGGACTTCATCCGTCTTATTGACTGCA
TCGCTGTTGAGAGTCTTGTGATTCTGGCTGTGCAGAGCTGCGCCAACTTTCTTTGCGAGCTGAACAAAGTTCCCCGTAAGACAGGACTCTTTGAGACGAC
ATTATTTTTCGGAGAGCAGTCCACCATTTTTGCCCCAACAAGTGAACAAATCAGCACATAGTAATAGCTATGACGGATGATATCGTGAGCACCGTGAATT
CAGTCTCGCGTGTGCTATACCTCCGACCATTTGCTGCCTATGTGGGAAACGTTGTTGCGGACGCGCCGCACGTGGGCTCTACCATTACGAGCAGCGTCGC
GTTCGGGCAGATCCGTAAGGAACTTGTTGCCAAGATCGCAAGCGATTATGCCGAGGCACTGAATATGTGAAAATCTTTGACAACGTGCGGCCTATCTACG
AGTACGACAAGGTTTGGGACCTGGAGGAGTATTCACAACGTGCCCACACGGTCACCACGCTCAAGGCAGACATGCTACAAATTAGCACGTGGGAGAAGGA
GCTCGAAAAAATGCGAGCTGGTCAGACTATCGGCATTCTACACGTGGAGAGCAGGAAACTGAAACAGACATTAATCCCCATGACGACAGCTAAGTTGGAT
GCTATGAAGGGTTTAGTGAAAGACTTGGCGCGTGCACGATGTAAAACTCAGCTGGGTGAGTACAAGCAGCGCATTCAGTCCCTGCTACAGCGTCCACAAC
ACTTGAAAGAGTTTGCCGGGCATGTGGAGCGTGTGCAAACTTTGAAGTCAAAGCAGAAAGCGCTCGCAAAAAACACGAATGTGGTAGACGAGCTGTACCG
TCTTCTGGGTACCTACGGCGTACGCATCTCATCAGAAGACATGGTGCAGTTAGATGACCTACGTGGTGTACAAGAGAGCTATAAGGAAGAGACTGAGGCT
GTTGAGGCTTTCGTAACGAGTCGTTTGGGTGAGATGACTCAGCAGTTGGACGCTAATATTCAGCGCCTCGACGAGCAAGTACTTCAGTTGCACAACCAGC
TGCAAGGTGGACTTTTCATTGATGCAACTCACTTCGAGGATCCATCAGTGGTTAAGAATGAACTGGAAAGTGTGAAGCAGCGGCTCACTCAGCTGGATGA
ACTCTCGAAGCAGTATACAGAGTATCAGTCGCTGTTTAATCTTACGCCATTTAAGTACCTGAACCTGCAGGCAACACAAGAGTACTTTGCCACAGTCGAC
TCACTTTGGACGGCAGTTGAAAAGTGGAACGAGCTGTACTTGGGTGCCATGACTAGCCCGTTCGTAGAAGTGAATGCGGAGGAGCTTCAAAGGATGTCGC
TGTAGCATTTAAGGATGCCTACGCATTGCACAAGAAATTGAGCAACGATGTTACTGCCGTGCTCAAGGACCGCACGGCTGAATTCAAGCTGAAGATGCCT
ACCGTTCTTGAACTGGGCAACCCAGCAATGAAAGATCGTCACTGGGAGAAAATCTTCAAGGCACTGCGGCAGCCTTGGTATCCTGGTATTTTGTTTACAC
TCGAAAACCTCGTAGCGTATGACGTGCTAGACATGAAAGACCTTGTTGGTGAAATGTCGGCAGCAGCTTCCGGCGAGGCCCAGATTGAGGCATCACTGCT
CAAGATTAAGCATGGGTGGGAGCAAATGGAGTTCACTTGCGTAAGCCACCGCGACCAAAACGACGTGTTCATCCTTGGAAGTCTTGAAGATATTCTAATG
CTGCTTGAAGATAATCAAGTGGGTCTTCAAACAATGATGGGGTCACGGTTTATCATGGGCGTGAAAGATGAAGTGGAGCGCTGGGGCAAGCGGCTGTCGC
TCCTATCGGACACACTGGATGAGTGGATCGCTTGCCAGCGCAGTTGGATGTATTTGGAGACCATTTTCTGCGCCGAAGACATTCAAAAGCAACTTCCTGT
GGAGGCCCAAAAGTTCGCACTCGTTGACAAAAACTGGAAGTCGACTATGCTACGAACAAAGAACGACCCCAGTGTGATTAGATCGGTGGAAGGTGGATCT
GAGCTCTTGGATCAGTTCCGTATGTCGAACAAGTTGCTTGAAGAGATTCAAAAGTCCCTAGAGGACTATCTCGAAACCAAACGCATGGCATTCCCACGAT
TTTACTTCCTATCAAATGACGAGCTGCTGGAAATCCTGTCACAGACCCGTGATCCACGCGCAGTTCAGCCGCACTTAGGCAAATGCTTCGACGCTATGAA
GAGTGTGCGCTTCGATGATACGCCCGGTTCAGCTAGTAACGTTGTAAACGCCATGGTGAGCGGTGAAGGTGAGCTCGTTGTGTTCCCTAATCAGGTTATA
GCAAAGGGTCCGTGGAAGCTTGGCTTACTGAGGTGGAGAAAGCGATGCGCGCAAGTCTGTATGAGGACGGTGTCAAGGCGCTTATGAACTACCCCATCGA
AGATGCTATTGATCGCAAAGATTGGCTATTCGGATATTCAGCGCAGATGATCATTCTCGTTGATCAGGTCTTTTGGACGCGAAATGTCACGGAAGCCATC
GCACAAGTTGAGAGCGGCAGCGATCCGCAAGCTGTTGGCGAGTTCCTACAATTCAGCTTGAAGCAGATTGATGGTATGGTGCAGCTTGTGCGTGGGCCAC
TGACGAAACTGCAACGCATTCTCATGGGTGCTGTCATCACTATTGATGTGCACGCTCGAGATGTAGTACGCTCATTGTCTGATAGTAACGTATCTTCGCT
GAGTGACTTTGAGTGGACTCGACAGCTGCGGTACTATTGGGAGGATGACGTGAAGAACTTTGTGGCTAGACAAACCAACACGCGCTTCATCTACGGATAT
GAATATCTTGGCAATTCACCGAGACTTGTGATCACGCCCCTGACGGACATTTGCTACATGACACTCACGGGTGCACTGCATCTACGTTTAGGTGGCGCTC
CTGCTGGACCAGCCGGTACAGGCAAAACAGAAACCACGAAAGATTTGGCTAAAGCGCTTGCAGTGCAGTGTGTCGTCTTCAACTGCTCGGATGGACTGGA
TTACAAGATTATGGGACGATTTTTCTCTGGCCTCGCTCAGGCTGGTGCATGGGCATGCTTCGACGAGTTCAACCGCATTGATATCGAAGTTTTGTCTGTG
ATTGCTCAGCAGGTACTTTGCATTCAACAGGCCATTGTAGCTGACGTGGACGAGTTTGAGTTTGAAGGCAATCTCATTAGACTCAACACAGGTTTTGGCG
TTTTCATTACAATGAATCCGGGTTATGCTGGACGTACGGAGCTTCCAGATAACTTGAAGGCACTTTTCCGCCCCCGTTGCTATGATGGTGCCGGACTACC
GTTTAATTGCCGAGATCGTGCTTTTCTCGGAGGGGTTTGCGAATGCTTTGCCGCTGTCGCATAAGATGACTCAGCTTTACTCGCTCTCCAGTGAGCAATT
GTCAAAGCAAGATCACTACGATTTCGGTATGCGAGCCGTCAAGTCTGTGTTGGTTGCTGCTGGCCAGTTAAAACGCAAGGAACCCGAAATGCACGAGGAT
CTGCTTCTCATCCGAGCTATGCGAGACAGTAATGTACCTAAGTTCCTTGAGCAGGATCTCCCATTGTTTCGCGGAATTATTGCAGACCTCTTCCCAGGCG
TTGTGGTGCCTTTTGTCGACTATGGGCTACTCCAGAAAGCCATTGAGCAACAGTTGGACCTGCTTCACTTGCAACAAGTGCCATCATTTATCACGAAGGC
GATTCAGGTTCACGAGACGCAGTTGGTCCGTCACGGTATGATGCTTGTCGGTGAAGCTGGTAGTGGAAAGACCACGAATGGATACGTGCTGGCGAGAGCG
CTGACTCAACTCTACCAAGATGGTGTTGTTGACCGCGATGGGTTTTACAAAGAGGTCCAGCGTCTCATCCTCAACCCGAAATCTATCTCCGCAGGACAGC
TGTATGGTGAGTTCAATCTCCTAACGAACGAGTGGACTGATGGACTAGTACCGAAGTTGGTTCGACAGTGTGTACAGGAAGCCGCTGAGTCTGACAACCG
CAACTGGGTCATTTTTGACGGACCCGTGGATGCTGTTTGGATTGAGAACATGAATACGGTGTTGGACGACAACAAGACATTGTGCTTATCGAACAGTGAG
CGAATCAAACTGCCCCACACACTTCACATGATGTTTGAGGTACAGGATCTCCGTGTAGCCTCGCCGGCTACTGTCAGCCGTTGTGGCATGGTGTATATGG
AGCAAGTGCACGTAGGATTGACATCCTTGGCGCGAACCTGGAAAGTGACGACGTTGGAACCGATTCTATCGGCCTATCCAGAGCTGTGCGATATGCTTCT
CTTGTTGATTGAGACTCATGTTCCTGTGGCGATTGATTTTGTCCGCGAAAACTGCCGAGAAAAGGTGCCCAGCAACAATGCTAACCTGATGCAGAGCTGT
CTCAATCTCCTGGCATCCTGTCTCGCTAGCGGTGCTGTGCAAACCGCTGGTGCTAGCAATTTAGCGGGACTTATGCGCATGTATTTTGTATTCGCTGTTA
CGTGGTCTGTCGGAGCAAACATCGACGACGCATCGCGTCCAAAATTCAATGACTTCTCCATGGGCCAATTCCGTTCACTGATCGACAGCAGTCCTGACGG
CACACCCGTGACTAATGTGTACGAAGTGGTAGTAGATGACTCAACTGGTCAGTGGGCCTCGTGGATCGATAAGACCCCGACTTTCACGTTTGTCCCGGAG
CGTCGTATTTCACGATGGTGGTGCCCACGCAAGACACGACGCGCTTTCGGTATCTCTTGGAGAAGCTCATGCTTTCAGATCATCACGTGCTGTATAGTGG
CGAGACTGGTGTTGGCAAATCTGTTATTGTCCAGTCGTTCTTGGATGATATGGCTAAGACAGATAGCTGCATTGCATCTACCATGAGTTACTCGGCGCAA
ACCAAGCCTCGCAACCTAAACGAGATGTTCGAGCTAAAGCTGGACAAAAAGCGAAAGAACTTGCTGGGTCCACCTGTTGGAAAGCGCATGCTATTCTTTG
TGGATGATTTGAATATGCCGGCGCTCGAAATCTATGGCGCGCAGCCTCCTAACGAGTTGTTGCGGCAAGTTATCGACCAAGGTGGTTTCTACGACACATC
CAAAATGTTCTTTAAAAATGTGAAGGATGTGGTGTTTGCCGCCGCATGTGCTCCTCCTGGAGGTGGTCGCAGTGAAGTGACCCCGCGTCTGATGCGTCAT
TTCCACATGGTTTGGATCCCAATCTCTCTGGTGAGGTTATGCAGCGGATCTTCTCGTCAATCCTCGGCGGTTTCCTCGGTGCAGAGTTGCCTGCAATGGC
GCACATGGCAGCACCTATTGTGAGCGCTTCGGTGCAGCTGTACCAGCGCGTGGAGCTCGAGATGCTACCTACACCATCGAAGTCACATTACACGTTCAAT
CTTCGTGATCTTTCCAAAGTATTCCAGGGTGTGCTGATGGCGAAAAAGGAGAATGTACCGAACGAAGATGGCCTGCTAACACTTTGGCTGCATGAAGAAG
CACGAGTTTTCCGTGATCGTCTGGTAGACGCTGATGATCGAGATTGGTTTAATGTGGCTTGTTCGCAACTACTCGAGGAGAGGCTCCGAGTTTCGTGGCC
TCCCGCGCTTCGAGAATATTTTGTATGGCGATTACCTTACGCGCGAAAACCGTACGTACCGACCGATTGAAGATCTCGGACAGCTCAATTCACTCCTGTC
AGAGTATCTCGAAGAGTACAACATCACGTTCCCGAGTCAGATGCACTTAGTGTTTTTCAACGATGCCATGCACCATATCTCGCGCATTTGCCGTGTTTTG
CGACAGCCTCGCGGTAATGCTCTACTCGTTGGAGTTGGTGGCTCAGGTCGTCAGAGTCTTACACGTCTTGCTGCATTCATGGCGGATTACAAGTGTTTCT
CGATCGAAATTACTCGTGGATATGGCGCCAATGAATTTCACGAAGACCTCAAGAAGATCCTTATGACTGCAGGCGCTCAAACCAGCCTGTCGTTTTCCTG
TTTTCGGATGCTCAAATCGTTCATGAATCCTTTCTTGAAGACATTAACAACGTCCTTAATACTGGTGAAGTGCCGAATCTTTATGCGAGCGACGAAGTGG
AGAAAATTGTGGGTCTCGTTCGTCCATTGGCTCAGCAGGTGGGCAAAGTTACACGCGAAGATATTCTCCAGTACTACGTGACTCTTGTTCGTGATAATTT
GCATGTGGTATTGGCATTTTCTCCTATCGGCGCTGGCTTCCGGAACCGCTGCCGCATGTTTCCGTCTCTCGTGAATTGCTGTACCATCGACTGGTTCAAT
GCATGGCCAGAAGACGCTCTTAACTCAGTGGCGAACCGCTTCTTCGCTACGAACGCTGAGGAGCTTGGTATTGACACACATGTGGACACATTGTGCCGCA
TGGCCGTGACAATTCACCGCAGTGTTGAAGAAGCTACTCTTCGGTTTTACGCCCAGCTAAAGCGTCGTAACTACACCACTCCTACGAGTTACTTGGAGCT
GATTCGACTGTACGTGGATATGCTGCGTACACATCGCCAGCTCGTACGTGCGAAGGAAGCACGTTACCGCGGTGGCTTGCAAAAGCTTACGGAGACCGAG
GAAGTCGTAGGCAACTTGAAGAGCTCACTTACTGAGTTGCAGCCGGTATTAGTCAAAGCTCAAAAGGACACATCGCTGCTGCTTGAACAGGTGTCAAAGG
ATCAGGCAGAAGCTGACAAACAGCAACAACTAATTCAGGCTGATGTCGAGGCTGCTAACAAGATTGCTGACGAAGTGAAGGTGATCAAGGACGACTGTCA
GAAGGACTTGGATGAAGCTATGCCCGCATATTACGCGTCAATCAAAGCGCTGTCACAGTTGAAAAAGGATGATATTACGGTGTTGAAGACGTTCACCAAT
CCCCCGAGACTTGTGGGTGTCACAATGAACGCTGTGTGCCTTCTATTCGGCTCAAAGCAAGAGTGGAACGAGGCCAAAAAGCTGCTTAACGATATGAAGT
TTCTGGACAAACTCAAAGAGTTCGACAAGGACAATATTCCGCCGAAGACGATTCGCCAGCTTCAGAAGTTTATGACTGACGAAGAGTTTACACCTGAAAC
GCTGAGCAGTATCTCCACCGCTGCAACATCGCTTTGTATGTGGGTGCGAGCCATGTATACGTATGATACCGTTGCCAAGAACATTGCTCCAAAGAAGGAG
AACCTTAAGGCAGCCGAGCAGCGACTCGAAGAGGAGCAAAAACAGCTTGATGTCAAGCAAAGCGGATTGAATGCGGTGCTCAAGAAAGTAGCTGACCTGA
AACGAACACTTGAGGATGCCCAAAAGAAGAAAGTAGATTTGGAGAAGCAGTCGGAGAAGACGCAGGCACAGCTCATACGCGCTGAGCGGTTGATCGACTC
GCTGGGCGAGGAGCAAGGCCGTTGGAAAGAGTGCGCTGAAAACCTGGGAAAGGATATGATCAATCTAGTCGGTGACATGATCCTGTCCGCAGGCTGCATC
GCGTACCTTGGCCCATTTACATCGGAATACCGTCACGAGCTTCAAGCGAAATGGGTCTCGTTCTGCAAGGCTAGCAATTTACCGGTTGATAGTCATTTCT
CCTTCCAGCGCGTGCTAGCCGACCCCGTTGTAGTACGTGAGTGGAATATCATGGGCTTGCCGGCTGACACCTTCTCAATTGAGAATGGGTTATTCACAAC
CATGGGGCGCCGCTGGCCGCTTATGATCGATCCCCAAGGACAAGCCAACAAATGGATCAAGAACATGTATAAAGCATCAAACTCACTCCAGATCATTAAG
CTATCGCAAAAGGACTTCCTGCGTACGTTGGAAAATGCGATCCGGTACGGCTCGCCCGTGATGCTGGAGAATGTGGAAGAGGACCTGGATCCTTCATTGG
AGCCCGTGCTATTGAAGCAAGTGTTCAAGCGTGGCGGCCAGAACCTTCTGCATCTTGGTGACAGTGATGTCCCATACAGCGACAACTTTCGGTTCTACAT
CACCACAAAGCTTGCAAACCCGCATTACATGCCTGAGATCTGCATTAAGGTTACAATTATCAACTTTACGGTCACGCTGACAGGACTCGAGGACCAGTTG
TTGGTGGACGTTGTGCGAAGTGAGCGTCCTGACCTAGAGCAGAAGAAGAACGAGCTTACAGTGAACATTGCAGCCGATAAAAAGCAGCTCAAGGAGATCG
AAGACAAGATTCTGTACATGCTTGAGAACTCCAAGGGAACATTTTGGATGATGAAGAGCTCATCGACACACTAG