Transcript Name :
Phyra_g14006
Orientation:
(+)
Number of Exons:
2
Description :
ETI34893.1 hypothetical protein F443_18695, partial [Phytophthora parasitica P1569
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-306
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4365 bases(100 bases per row)
ATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGC
CCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACCTCGTACGTGCTAAAGC
ACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACG
TCGAGCCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCG
CGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGC
GTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCG
CAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTC
GGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGTTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGG
AGTAATTTACTTAAGTTTAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTG
ATTGTAAATGGGGTTTCCTCCTAAAACTGATATCTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGT
AGAAAGGTGTTACTTTCTACCAGTCATAAGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATCCCTTAGTGCATGTTGCACTAA
GGTAGGAGGTGAACCGAATGTGTAGCCCCGTTACAAAATGCTTCATCATAAGGTAGTAAATAGTTAGTCAGTGTTTCCTGGTAGTTGAACGAGTTTTGGG
CGCCACCAGAAACTCCAACTTAGTCTTGCCTATCGAGGAAATCCGCCACCGACCATGCCGGATTCCCCGCCATTTTGGCGGCTGAACGATATTTTGCATC
GTAGGTCATGCAAGTAGTACTGTAGCCCGTCCCGACAGTCAAGATTGTTTTCTTCATCGGAGAGGCAACTTCATCCCAATCGGTCCGAAGGCTCATCACG
CTTCTCGCCCACTTTCGACGGGGCAGCTTGTGGTAAACTTTAGCTTTTGTGTGGTATTGTAATCCACAGAAAACGTCGTTAGTGCGGCTTCCACGTAACA
ACACAACAATTCGCCGAGTCAGGTCGCGTTGTTGGGCTTGCGCAGAGTTCTGTGGTTCCTTGGTTTCCTTTGCGGTTCAGCCCAGCCGGGTCCAGTCGAG
GCTCTGTTTTCGTGAGTACCAATCAAAACTCCAGAAGCTCGCCTGAGCGGGGTAGCTTCCGTTCTTCAAACCCTGTGACTTCCATCAAAGGATGGGCGTC
GGCGCGCTAGCGCTTTTACAGGTCACGAGCGCAGAGTACGCTCAGCTAGAAGATTGCGGTGTCCTGGTTGTGCAGACCCACCGACTCGTCGATTCGACGA
GGTTTGTCTTCGCTGGTAGCGAGAAGTGCCCACCCCGGGCCGACCTTGATCTCTTGGCGCTACCAGTCGATTCCCCTACAGCTATGCCTCTTGGGGAATG
ACGGCAGACATAATCCAGCCCACGCAGGGACTTACCGGAAAATATACGCTGTTCTTGGACTTAGAAGATTCTGCTCTGTTTTGTTATCTCTGTGTCTTCA
GGGAGTCCTTTCGGGCTCTCCCCTTTGGTCTCCTATCGATCCTATTCAAATACCCAGTGAAATGGAGTCGTTCTAGATCTCCCTGTGACTCTTCGCTCAG
CTTCCTAATTGATCCTCGCCGAGTTGGGTCGTTATGGATCTCCGCCGACCTTCACTCTGATCCCTGATTTATCCACTCCCACTTGGAATAGCTCGCAAAT
GGTATACGCTCACTGAGTTCTGCAGCTCGCTGAGTCTTTGGCCTCGCCGAGTCCGTCGCTTGCTCAGTTCTTCGCTTTAGTGCGTACGCTAATTAGATAC
GATGTATCCAACTGGGCCAGACCAGGTGGTCCACACAAAATATTGAGTTTCCATACACCACATTGGGGTGCCGTTGTGCTTGTCGTAGTTCAGTTGGGAC
ATACTAACAGAACTGTTGTCCCTGTGAAGATCAAGATTGGCGAGGAGCATGATAGCTTTGAGATGGTCTACTCATTAGCTGAGGCAAAGGTAAGCGGTGG
CGATACAGTTGTAGCGTGCCGTCAATTATGATGTGGTGTTCACGGCTGGAATTTAAGACAAGATCGCTCGTACGGACTCACCTTCGTCGTGCCAAGTGAC
AACAACGACACTCGACATTTTCACATTCCGATTTTCTTCCCATGCAAACACATCGAACTTTCCGTAGTCCAGCGCCAGTGGTAGTGACCATCACACTTTT
AGCAGAGCCAGTGCGTTTCCGCTTCCTTAGTTGAAGCGTAGGGCTGTGAGCCCACCTAAACCATCGACAATGCGTCCACAGTGTGCGCACTGTCGATGGT
CTGGGGGTATTATGCTGGGGATATAAATGCCTTTGACCAAAGACAAACTGCACATCGTTACAAAGTATCTCTGTAGAGGCCCTCAAACACATTTTTGACA
GTGTACAGTACTTACGTACAGCGTAATACAATGTATTGTGCTGTACACTTACTCCGTTGCTTCAATAGTTCATTGGCATGTACCTGTACTCGAAGCGCGG
ATCAACCGACTATCAGTAGTGTGCAGCGTAATACACTCTATTACGCTGTACACGACATCATGTCGTCGACATATACTAGAAGCACGGATCAAGAGCCTCG
AATGTATCACTTCCGATTTCTTCGCCATGCAGACACGCCGAACTTCCCGTATCTCAGCACCAGCGATAGTGATCGTCGCACTTTTGGCGCTTGCAGCGAG
CACCTCTGTCACCTCGGCAGCCAAGTGTTTCTACTCCAAGTCTACGAGCACTCCTTCTCCTGGTCTACATCAGCACCCGACGTCACCGAAGCGCCGATTT
TGGAAGACCCCACACCTACCCAGACTGATTCGTTTGGAGCTAGCCAGGCGACCGACGGAAGTTCGTTCCAGGCACAGAGCTCAACCGAAGCATCAGCAAC
GCAATCCGGATCCTATGAAGCAACCCAGACGAGCGAAGACAGCTCGAACGCTGCCCAAAGCGCAACTGAGGGATCGTTCGAGTCGAACGAGGTAGCCCAA
GGAAGCTCATCCCCAACACAAGGTTCGTCCAGCGAATCGACCGGGGCTGTTCCATCCACACATCATCGGGCGTCCATGCCACGTTTGGAGACATCACCTC
AGCCACTGGCAAATGCGTCATTGGTGACCCGAACGCGGACCTCACCCGCGAGGATGTGGACTGGGTCTGGAAGAACACCATGGAGGAATACGTCCCGCAG
TTCAAGAACCTCATCTTCGACCAGCTCGTGACCAACAACGGCTCGCTCAGCTACTGCGTCCGGTGGGACAACGACCTGAAGCTGACCAAGTCGGTGGCAT
CCAAGTTCCAGGCCATGATCGAAAAGCAGATCAACCTGTGGAACCGATGGCTGGTTGGGTACAATTGCTGGCCGATCGAGAAGATTGACATCACCGTCGT
GGGCTTCGCAGTGCGCGACAAGTCCATCATGGACTGGAGCGACGACTCCCTGGGCACGATCTACGAGGGTATTCTGGACGCCGAAGGCAGTCCCCAATGC
CCCGACGAATGCTACAAGCACAAAGGCCAGGCTGCTAGTGCGGATACAAGTGCGTGCAAGGGCAAGCCGTTCGACATGTCGCTGTGGCCGTCGACGAAGC
CTGGAGACGGCGCCATTGGTACGGGTGGCGACTGGGGCCAACGCGTTGAAGTGAACGACATGCTGGGCACCATGGACGACGAGGAAATGGTGGTTCTACT
GCACGAGATGGGTCACGGATTCGGCTTGCCGGAGATGTATGTGGCCGAAAACAAGCCCAGCGGCTACCCCGCCTGTGTGATGGATGAGAGCCTCACGCTC
ACCGACGGTGACGGGTGGTTGGTGCGTAGTATTCTGGAGAAGATCAAGTCTCGCTATGACTTTTA