Transcript Name :
Phyra_g13960
Orientation:
(-)
Number of Exons:
9
Description :
RAW33967.1 Large subunit GTPase 1 [Phytophthora cactorum
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-604
*** None ***
PositionContextScore
574RKGRKGR|DK0.693
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2358 bases(100 bases per row)
TGGGTCGCACGGGGCAGAAGGTCAAGAAGGGCGGGCTGGGCAACGCCCTGCTGCGCACGCAGAAGAAGACGTCGGCCATCAACACGAAGGACGTGGCGTC
CAGTGCCGGCAAGCACGTGTCCGAGCGCGATGGCGGCGACGCGTCCGTGGCGTTGGCCTCGTACCTGGAAGGCTCGTCCCTGGTATGCAACACGTAGCGA
GAAACTTGGTGGCCAATGGTCTCACTATTCTACTATTGCTACTGTAATTGCAGGATGATTTCCTGGCCAGCGCCGTGCTGGCCAACCGCGAGTTCACCGC
CGTGAAGGAGAGTATCATGCTCCTGGAGGAGGCGGACGCCGGTCCGCAGCTGATTGAGTGCGTGCAGCTAGACAGAGGTGCTGCAATTGAGTGGTGGGGT
AGCTCACTAATTTGCCGACTGCAGGAAGGAGAAGAACGTGGCTCCGGAGATGACGTTCGCGGAGATGAAGGTGCCGCGTCGCCCGAATTGGGACGCGTCC
ACGACGGCCGACGAGCTCAACCGACTGGAGAAGGAGAGCTTCCTGACGTGGCGTCGTGATATTGCCTTGTGAGTAGGGGTGCTGCATACGCGTGAAGAGT
CCAGTTGACTCATTTTTTGCTGTCGTGGCGTAGGCTGGAGGCGTCGTCTGAGCACCTAGAGGTGACCCCGTTCGAGAAGAACCTGGAGGTGTGGCGTCAG
CTGTGGCACGTTCGGGAACGAAGCGATATCATGGTGCAGATCGTGGATGCCCGCAACCCGCTGTTCTACCGGTACGAGTTTGCTTGGATACTGCACGAGA
AAGGTGACGAGACTAACATTTTTGGTTGCAGTTCCACTGACTTGGACGCGTATGCTAAGGAGGGCGATACGCTGCGGCGCACACTGCTGGTTGTGAACAA
GTCAGACTTCCTGGACGAGCGCCAACGGTGAGTGCCTTTTGATTTGGTTTAGTATCCACCCTGCTGGTGCAATTCCTAACGGTTTGCTGCATTTTCAGAA
CGGCGTGGGGTGATCACTTCACGGCACAAAACATTAATTTCGTGTTCTTCTCCGCCAAGGAAGCCCAGGACGAGATCGATGAGGAGGCGAAGAAGTTGAG
ACAAGAGCAGAGAATCGCTGAGACTCACGACCAGTACGACGAGCCAAAGCCCGCAGATGCGCCACAGGTGGCAGAAAGCTCGGTTAGCATCCAGGAGGAC
AACAGTCCGTACCCTGTGCTCTCTCGTGTCGAGCTGCTTGAGCATGTGTCAAAGACTGCCACGGAGGTGCTGGAAGAGGTGGGTATGCGAGTGAAGGATA
AGGGCTTGATCAAGTTTGGTATGGTGGGCTTCCCCAACGTCGGAAAGAGTTCCGTGATCAACGCGCTGCTGGGTGCGTCTACGTACTCGCACAAGACCCA
GCGTGTCGCTGTCGGCGCTACTCCCGGAAAGACCAAGCACTTCCAGGTTTGTATGAGGTCGTCTTTGCCGACGCCACTCTTGCATTTACTAACTTGTTTA
TTCCTACAATCCGATATGTAGACTATGATTTTGTCCGACAAGATCATGCTGTGTGATTGCCCCGGTCTCGTGTTCCCGAGCTTCGTGAACTCCAAGGCCG
AGATGTACTGTTGTGGAGTTCTGCCTCTTTCGCAGTTGCGCGACCATATCTGTACGTCAACGTGTCCAATATCCTCTTGCAATCTCTCGCCTCCTGACAA
ATATGAATCGCTCTACAACTTGCGTAGCCCCATGCCAGCTCCTGTGCTACCGCATCCCGAAGCGAGTATTTGAGCGGACGTACGGAATCAAGATCCAGAC
GTCGAAGACAGCGAAAGAAACCGACCCTGTCGGCATCTACGCGCTTCTGGAGGTGCGTGAGTCATGGAATAATGTGCGATTGCTCGAAACTCACCTCTTG
TTCTCTGCTAGGCTTACGCTCGCAACCGAGGTTACACAACGACTGGCAAGGGCGGCCCCGACACGTCGCGCGCAGCCCGTGACATCCTGCGGCACTACGT
GAATGGCCGATTGCTGTACTGCCATCCGCCACCGGACGTCGCGGACCCCGCCATCTTCGACATCCATATGCTAGCTAAGGCTCAGTTTCCCGACCTTGCG
GAACCTGTCGTTCCTGAGAGCACTGAGGACGACGCTAACGACGAGGCTAGCTCGGCGACGGAGGAGAATGCAGAGGAGGAATTGGACTTTGACACCACTG
TCGAAGACAAGCGTGCGATGAGTAAACGGCTGAAGAAGCACGGCCGTAAGGGACGTAAGGGCCGCGATAAGAACCCGTACGAAGACTCGGACTTGCCTGG
TGGCCTTGCTGGTGTCCACATCAACTCTGGTGGCAAGAAGAAGAACCGCAGACCGTAA