Transcript Name :
Phyra_g7518
Orientation:
(-)
Number of Exons:
16
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Bromodomain15.742PS50014
FY-rich, C-terminal11.131PS51543
SET domain15.26PS50280
HmmSmart predictionP-Valprediction_id
Bromodomain0.00000000012SM00297
SET domain3.8e-32SM00317
Mannose-binding lectin0.000037SM00915
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Mannose-binding lectinIPR001229
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
nucleusGO:0005634IEA
*** None ***
*** None ***
Sequence
        40460 bases(100 bases per row)
TGCAATTTGCGTGTCTTGTATGCGAGCAGGTCGTGGACGATGTACTCGTGGCGGAAGCTCTTGATATCGTCCAGCAGAGCGTCCGCAACACGACGGACGC
TGCGCGCCTCTCTACCTCGGAAAAGCCGTCTTCTCTCGCCTCTATCGACGGGATTGCGACAGCAAAAGAAGCTCACACAACACAACATACACCCGAGAAC
ACACAAATGACGCGTTGCTGCGTTTGCGCCGGTATTTACCACACGCCGTGTCTGCAGAAGACTGGAAACGCCCAAAAGGGACAGGATTCGACGTTTACGT
GCGTGAAATGCCGTCCAGAGACTGAGAAACAGGTTGGTAGTGAGCATGAGACGGCACACGAAGAACTGCTGCCGATTCTGGTGCCGGCACTGGCGTTCCC
GTACGTTAGAAGGCCGAGAAAGTCGGAAAAGGACGGGGATTTGACGGTAGAACGCGGAATTTCAGCAGAGAAAGAGGTAGCAGATGACGGAGTTATGGAG
GAGAGCGCAGACGAGAGCTGGCGTGTGTTTTCGACGGAGGTGGAGGTGTGCACGACGTGTCGACAGGTGGAGATCGCGGCCAAGGAGAGAGAGAGCTGTC
ACAAGTGCCACAATGCGCGGCTGCATCAGCGCTGCGTGCAGCTCCACCAGGCGGAACATGGAGCAGGAGTGAAGAAAAAGAAGGCGTACCGTGGCACTGG
CAAGAAGAGACGTCGCGCGTCCTCGACGACCACGTTGGAGTGGTGTGCGCCATGTTTGCTGGAGAATGAGAAACACACCCAGCAGCTTATTGACGGGTCC
ATTGAAACGCGTACAATTGCGATGCTTCTGAACGAGAAGGAGAAACAGCAAACGGACGACCAAGTGCAGTGGTGGAAGGTGTGCAGCGTCTGTAAAGGGC
ACTTTTGTATGCAGGAGTTTTGCGATCCACAGGAAACCGACCCGAGTTTGGATGAAATTCTGGCCAAGACACGAGACGAGGACGAAAATGATGCCGCGTG
GAGCTGCGGACATTGTGCAGCGTTCGCCCGGTCGCTTGCAGGTGACGCGCTTGTAACGGTGCTGATTTGTGACGGTTGCAATGGTGAATTTGATATGGCT
AAACTGGATCCGCCGCTGGCAGAAACCCCTGAAGGGGATTGGTTCTGCTACGCTTGCAGTGGGAGTGCAGATTCCCCCTCGACTGCAATAACGCAAGTAA
CGAGCCCCCAGGAATTGACGACGGTGATCATTTGTGATGGATGCGAGCGCGAGTTTGACATGGCAAGTATATACCCGCCGTTGAAGAGAATCCCAGAAGG
CGACTGGTTTTGCAACAACTGTGTTTCCGAGGCAAACGAATCTGCCGCCAGTTCTGCGAGTGGTGTTCATAGCGTGGCCGCACCACTAGTACCCGTGACA
CTATTGATCTGTGATTTGTGTGAAGGTGAATTTGACATGAGCGTGTTGGATCCTCCTCTTACCGAGGTGCCAAGTGGCGACTGGTTTTGTTCAGCGTGCT
CCAGACAGGATGTTAAACAAAGTGGAAACGACCGCCACTATCGCTCGAAAACTGGCATGCCAAAGCGACGCCGCTCCAATAAGCAACAGAGTGTAGTGCC
AGCACAGTTTACTGCCCAAGAAGTGGTTGTGACGGTCTTGTTGTGCGACGGCTGTGATCACGAATTTGACCCGATGGCAATGCACCCACCAGTGCTCGAG
ATCCCCGATGGCGAATGGTTCTGCCCAGCATGTACTAATGCTCGTGAGACAGCTTCTGATACCGTGCAGACTTGTGTGGGCTGTGACAGTAAGTTTCAAA
CGGGTGGGAATGCCGTACACCGCCCGAGCGGAACCGTTGGCGGCGTCATGCTATGTGAAGCTTGTCGTAATTTGCAGGTTGGCTATACGCGTAGACGTTC
TGTGCCCGCAGGGACTGCCAGTCACGAGGCAAATGGCGTTCCACCGTCAGCAACCAGCAGGAAGCGACATCGATTGGGTGGAAACAATAATGGCCAGAAT
AATCCCAAGAAAGCCAAGATAAACCTTGGCGGTCCGCCTGTGGTGGATGGCGATACTGAAGGGTCTCAGGCTGCAAGCCATCCGAACAATGCGTCTGGTG
ATGATAACACTGGTGTACGCATGCTTATTCCGAAGCCAATTACTATGGTCACATCTTCTGCAGGCCTTCGGAATGAGTTTGACGGAGTCAAGATCACCAG
CGGATGGAGCTACACCAACCCAACCGTAGTGATTGCAGACCCGGACGATACCTTCGTAGCGAACAGCATCGATGACGTCGAAGAAAGCGGAATTAGCATT
GTTTGTGATTTCTGTTTTGGCGAGTTCAAGATGGAAGACGTGCTTGGCACCAGTGACGCAAACGCCGTCCCTGCGCGTCCATGGTTTTGCAAGCCCTGCC
TCAGAGCTCTGAAGCGAAGCAGAAAGAAAAGACCTCGCTTCTCGAAGCAAATGGTACTGGAGATGCAGGTGTATGGACGCCTTTTGCGCGCTACTGCTGC
CAAAGTCTCGGATGTAGATGCTGCCATCCGTTTGGGGAACCCACCAAACTCGCGCGAGGAACGGCGCAAGATGTATGAGCTTGTCGGGAAAAGCGTGGGG
GTGTTTCTGCAGTGGGATAAGCAGTGGGTTATGGGGCGTGTTGTGGCATTCCATGCTACACATCCCGCCATGCACCATACCATTCGCTTTGATGATGGAG
TGGTTGCGTCACTGCCACTGTACGCGTTCCCAATGGTGATCGGGACGCGCACGATGCTGTACGTCAAGGTGCCTGCGCTGCAAAATCGCTGGTGGCCTGC
CCAAGTCCTTCAACTTAACGCCCTCGCGCAGAACCTGTTACTGCCAACCCGCGACGAGGTGATTGGAGCACGTGCGAATTTCCGCCTCGTGCGCATATTT
GCTAGTGGCGATGAGCACGTTGAGACTACACGAAATGTGTCGTGCTGGGTGCCGAAGTACCTATGTCGAAGTATGAAGCGTTTTGCTCCTCCTTGTTCAG
AAGATCCAGCGACTGCAAGATCGAAGGAGTCTGTGGGAGATGTCTTTGCAAAATCTATCGGGCGAGCAGAGCACGAGGCGCAAGCGGAGACAGAGCGTCT
GAACCTCGTCTTACAAGCTTTACTAGCTGGCTTCCGACGAATGATGACAAATGCGGGGCCATCAGTACCAGACAAACCAGTGAAAGGTACTAAATCGGTA
ACTGGACATTTGGATGTTGGCGAACGCTGCGCTCAAATCGCCGAAGCTTTGGTTGGCAAAGCTATAAAAGTTACGTCAGTGGGCTCATGCGACCAGGATC
TGTCACCTGGAACGTTTGTAGTAAAACGATTCGACACAGGCACACAACTGCATGCCATTCTGCGCCGTGACGATCAAGCCGATGCTACTTCTGAGACCAT
GGTCAATTTGCTTCAAGGAACGGATGGCATTGTCTACCATTTGGAAGACGCTGGCGCATTCAGCGAGTTGGCAGTTATGCTGGAGCTGAGTGGCTCGGAC
GTGGGCGGAGGCATCCCCGGAGAGTTTCATTCCAAAGAACTACTTGAAAAGGCAATTATTCGAGAAACCGGCGTGCTTCGTGGCACCACATTCGCGGTGA
CTGCAGATAGTAAAAGAGATGGACAAAAGGACGCAAACAAAGCTTGCAGCTGCTGCTTGCTAGAACCAGATGAATGCTGGAATGATGTCGGCTCAATTGA
TGTGCCTGACAGTGGAGAACGAGAGGAAGAGATGGTGGTGTGCGCAAAGTGCGACCGACGGTTCCACGCGACCTGCTGTGATCCCCCCCATGCCCCGATT
TCGCTTGTGAACCCAGAAGATGGGCAGGTGCTGGTGTCAGACCTGAAGATACCGTTCGTGTGTAGTGATTGCACGTCGTGTGCAGGATGTCACCGCCAGA
AAGATGACGATGAAGCAGCTACTGATCAGCCCGGTAACACTTTTAGTATGGAGCGGGTGGACAAGGCTGCAGAAGATACAAGCCCGCAGTGGTCCCAGTG
GCGACTTCCGCTGCAGGCTGCTGCACTTTGTGCACAGTGCATTCCTTACTACAAGGCCAATCGCTTCTGCGGTGTTTGTAACCTGGTGCTGGATGACGAG
CAGCTGGCAACCAGTGTGGATTTACTTACATGCTCGACTTGTCATCACTGGATTCACGCAGATTGTGAGCCAGACCCACATCCTGCTTTCCATGCGTTCA
GCACAGGCAATGAGTTCACGTTGGATGTCATCACGGATGCATCAATCGAGCAATCGAATCCATCCCAAGGAGGTGGCGTCGTCTTTGCAACGGCCCCAGT
TAGTCGTGAAGCTAACACGGAATCAATGCCCAGTCTGAGAACCCCAGTGGGCAGCCGTAGCCCATCGGAGGAGCGCGAAGTGCTACCCAATGGGAAAGGC
CCTGCAATCAGGGACGACGCAGCCTTTAAGACTGCGAAACAGGTTGAAGAAGACTTTGCTCATTCCTTGCGCTTTGGAGCTACTTACGATCCGAAGGTGC
TGCACAACTACGAGTGTCTAACTTGCCGCAAAGTTCGCATGCTTCATGTACTGCATCGTCTGGGTGTCGAAGATAAACTGGACCTGTTCAAAGAACCTGT
TACGGAGGCAATCGCTCCCACGTACTTCGACATCATCAAGTCACCTATGGATCTGAGTACCATGCGAGACAAGATCATTGATGGCACGTACACACGCGTT
AACTTCCGAGCTTTTCGTGACGACTTCGAGCTCATGTGCCTGAACGCCGTTACCTTCAATTCAAAGGAGCGGGACTTCCTTATTTGGCGTGAGGCTTGGC
GATTTTACGGGCAAGGACAAAGGATATTCCGTCAGACGGCACCCAAGGCACGCATGAAGCAGCGAGGAGGACGCCACTATGATGCCCTACTCGTTGCGGC
GAAGCGGCAGCTGCCCAATAATTCAGCGCTAGCTGGGAAGCCCGATTCGTCGGAGGCTCGTCAAAACGGCGGCGATGGTGGAGATAATGATGACGACGAT
GAGTTTGACGACGATGAAAATGGTGATGCCGGCTCTGATGCGGAGTCTGAAGCACCTAGCCGAGGAAGCGGGCTCCTTGATACTGGTACCTCAGCTACTG
CGTTGACATCTGAAGTGGCATCTGTCAACGACAGCGACACTAACAGCGACTTGCCTGACTCGACGGGCCAGATTCATCGAGGGGAGGCTACCCGTGATGC
GACGACAGCTTCAGCAAATGGCACGGCCTTAGCTGTGACAACGGCACTTTCCGATCGTCGTATTGTTACGAATGATGCACCCATGTACCAGACAAAGCTT
CGCAGTGCCAACTCGAGTTCGCGCATACCGTTTTTCCAGATCGTACAGACGCGTACGTCCGCCCACTCATACAGTTGGTTGGATATGTGCGCGGTGTGCG
GCAGCGCGGGTCTTCAGAGTGACTTTATTTTCTGCGTGGACTGCGGAGAAGGGTTTCACGCATTCTGCATTCCCAGCTTGAGCGCTACCCGTCTAGAAGG
CAACGAGCAGCTGCGTGCGTACTGGCGGTGCTCAAACTGTAAAATGTGTGAGATATGCGGCCAACCTGGGGCCGTTTGCGGGGCTTCCAGCAACCCCGGC
CGTATCCCTATCACTGCTGGAAATGTGGATAGCCCAGCCATTGCACAGACGAGCGAAACAGATATGTTGGCTGAGCTCTCTCAGCTTTTGCTATGTGCTC
ACTGTGACCGAAGCTATCATGGATCTTGCCTGGTGCCGGCTATCAAATTACCATCGAGAAAACGTGACGGGACCGCGTCGCCTCCGGTTATTTATTGTGC
CAGCTGCATAGCGTGCACGAACTGCAAGAGTACCAATGGTGACAATGTCGAATATTTGCATACGGATGAAGCCCAGAAGGACCACATTGCGACGCTGGAA
CGCACATACAGCTACGAACAAGACAAGTGTTTGCACTGTCACAATCAAAATGAGCGGGAAACGCAAGAGCTTATGCAGCGCACGAGGCTTTTGACCGAGG
TGTGGTCAGCAGCTTCACGGAACAAGAAGAAGGACGCGGAAAAGTGCCCACTTTGCCGGCGCAAGTGGGATGCAGATCTCGAGGAACTTATGCAGTGCGA
TGCTTGCGAGCGCTGGGTGCACCCCCCATGCGATGAACTCTTGAAGGCGGAACCGAAGCGGTACCAACTTCTGGTAAACGATCCGAACGCGGTGTATGTG
TGCGCTGCTTGCCGCCCGCAGAAGCGCAGACATCTTGCTGGCCAATTCCCGGACGGTGAAGGCTGGCGTTGCCAAGTTCTCATTGCCGAAATCCAGCGTA
AGCGCTCCCAATGCGAGTCAAGCTGGAAGGAAACGCAAGGCAAGCACAGTTGGAGCAGGTTGAACGCTGGAAGCGTCTGGCTGACCACACGCCTGTCTAC
CTGTACGTCCTGCGCCTGGGAGAAGAGTGTCTTCGCAACTTTTCGTACCGTAGCCTCAACTTTCAAGGTGACTGGTATCGCTTTACGAAACAGCAGGAAC
TCGATGCAACTGGACTGGCTCTTCCCGAATGGCTACTGCGCAAGGCCAATCGCTACATGAGGTTTAAGCGATACATGCGTGGGCCTTGGGCAGCAGCACG
ACGCAGTGAACGCAAGACGCAGAGCTTCTATTCAAAGCAAGCTGTGGGCATCAACACGCGCAAGGATGCGAGTGCAATTTGCACGATCGTATCCGAGGCT
GCGAGCTGTGCAGCTCTGCTAGCCTGCGTGCATCTTCTGTATGGGTGGCGACCGCTTACGGAAGTTGTTCTTCACTTGCTGTCGAGCGATGGAGAGGGGA
TAGCTGGAACAGAGAACCGAAAACTTGACGAGCCGCTGCTGAAGCGTCTGCGAACTGATGAGAACGCTGATAGTGAAGAATCCAAGCCAAGACTGAAACT
GGAAGAGGAAATTGCTGCGATCAAGGAGCAGTACAACCGTCGCGTAGCAAAGAGGCATCTTGTCCGCGAGCCAGGATCAGACCTTACGGTGTTTGGCGTT
GGCGATGCCGCAGTGAAGACTACCACCTCTTCTACTCCTCAACCGCCACCAGAGATCGAATTGCCTGAGAAGAGCAAGAGTGATGCCTTGGAGTCGAGGA
CATCAGAACAGGAGAAACACAAGATCGACGAAGGCACTGAGGCTAACTCGGCCTTAAGTGTTCGTACGTCGTCGTCGTCAGCAGTTTCATCGCCGCATCC
TTCATCCCGGGCGAATCATAGGGCACTGGTTCACTTGACGACAGCGCCGCCCCTGCAAGGTTGGCCAACGAAGAAAGTGGAAGGCGCTGAAATGGAGGGC
GATACGTCTGAAGTTGACGGCAATGCGCCTACAGAAATGCTGGCGGCTACGGCATTTGAGGACACCCGATTCTGTGCTTTGTGCTTCATGATAGGGGATA
ACACAGCGTGTGGACGCCTACTGTACACTGAGTCCGAGACGTGGGTGCATGTGAACTGCGTGCTTTGGTCTATGGAAGTATATGAGGATGCTGCAGGTGT
TCTGCACAGGTGCAACAAGGCAAAGCACCGCAGTCGCCTCATTCGCTGCGATGGTTGTGGACTTATGGGGGCTACTGTCGGCTGCTCCATTGTGCGCTGC
ACAACGCACTACCACTTTCCTTGTGCGGTGGATGCTGGGGTAGCGTTTCTACCTAACGGCGAAACTTGCTGTCCTTACGCACCTCACTTGGAAATGGTGG
CACGGAAACTGCAGGCAACAAATGGATTGCCGTTAGCAGTTCCCTCTCCCGAAGATGTGGACCCCAAGGCGGAAAACCCACAGCCAGCTCTTGAGAGCGT
GGCCGCTGGAGCAGTCAGCGCTGTATCGACTGCAGGCGAGGGCGATCCGTCGAGTGCTGTTGAATCTGCGAGTTCAGCGGAGGAAGACGGAAGCAAAGAG
ATGAACAGCCCCGGAGATGCTGCTGGCCCAGGATCTAAAACTCCAGTTAGCGACGATGCCACCGAGTCTAGCGTTCCGCCGGCGACTCCAGAAAGTGCAA
GTACAGCCGGAGCTGAGGAGGAGTCCTCTGCTGGTGAGAATATTGAAGACAGCGCATTGGACCCACAGCTGAAGCAGGAGCGTCAAGACAGTGTAACTTC
CCCACCACAGGACGAGATGAATCCCGTCGAGGAGCCCATGGACTCAGCTCCAAATCAACCGCAGTGTGTGCTGCCAGTGATTAACCCTCGACCGGAACCA
CGCCGAAGCCTTTTCAGTGATCCGCCACTCGTGACAGCTTCCGATTTGAAGAAGAAGAAGCGTGCAGAACTCAAGCGCGGCATCAAACCACGGGCGCTGT
GCTACCGCGTGGGTGCCTTAACGGTTCACTCTTTTGGACACGTGTTTGTTGGCAACGGAAGTTTCAATACGCGAACAGCTATCTATCCGTTAGGCTTCCG
CAGCACTCGCATTTTCTGGAGCACACGTCGATTAGCGACGCGCTGTCTGTACGAGTGTGTGATATCTAGCTCTGAGATTGAGGAGCGACGTGCCCGTCAG
CAAAAGAGGCTGGAAAGTGACGCAGGTGATGGCAATGAGACCGACGATGGAGAGTTCGACCAACAACGACAGAGACCGGGGGTAGTTTTCAAGATTACGG
CCTCAGATGATCAGGAACGCCCTATTGTTGCGTCTACACCAGAAGACGCGCTCATCGAATTACGTAGCCGCGTGGTATCGCTGTATGAGGAACAGCGAGG
CTTTTCTGCAACCCCCCGAGCTGGACGGCAAAGCCACGGAAGTGGCACAGTGGAGACAGAGCGAAACCCATTTTTGAAGCGCAGCTCGTGGTTTTCTTTC
GCTCTGAGCGGCGACTACTTTTTCGGATTTGGGCTACCCGAGGTTATTCGCCACATTGAGGAGCTTCCTTATGCGGCTACCACAGCGGTTAGTCGACGCG
CTATCGTGAGGAAACTTCGACAGCAACAGCAACGACAGGGACAGAGCCCGCTGGCCGGCTCAGCTGCGGCAACATGGGGGTCTGGCTCGCGCAAGAGGAG
CCATGATGCTATGGAGCAGAGCGCAGTGGCTGCTTTGGCTTTTTCCTTTCTTGAGGATGAGGACGAAGAGGAGCAGTATGAGTTCACGCAAGAGCTGCCG
TCCGCGGAGGCCTTCCAGACTGCTGAAAGAGTTGTGGAGCAGCTTGTGCGAGCGGAACAGCGCGCTCGACAGTCTTCTGGGAGCGCAAGGACGGACGGAT
TCGAGGGTAACCGCCTCTTCGGCACACCAAAGAAAACCAAGATCATGCCGCGGCGACAAGCTCTCAACAAAGAGGCGACTAATGAACCTGTTGCGGGTGC
TGCAAATGGCACCGGAAGTGGAAACAGTAACACTGGAGGTGTGGCTATGGATATCGAGCACCTTCCGATCACTATGCAATACCGAGAGCTGCGCCGTCGG
CCATTTGACGAGCGCATGCTGGTTCGCAAGTCGTCAATCCATGGCTATGGTCTTTTCCTGAAGGAAGCGGTCAGCGAAGGCCAGATGATCGTCGAGTACC
AGGGTCAAATGATCGGCCAAGTCGTGGCAGACGAGCGGGAGCGACGGTACGAGGAACAAGGCGTTGGTAGCTGCTACATGTTCCGACTGGACGAGAAAAC
TATTATCGACGCCACGCGGTGTGGTAACCTGGCCCGCTTTATCAATCACTCGTGCGACCCCAAAGCATTCGCGCGCATCGTGGCGGTGGAAGGCGGCGAG
AAGAAGATCGTGATCTTTGCCAAGCGTGCCATCGCGGTGGGTGACGAGGTCACGTACGACTACAAGTTCCCGATCGAGGACGAGGCCATTCGCTGCGATT
GCAATGCCCCCAACTGCATCGGCCGTATGAATTGACAGCATTAATACTTCTGTTCTAGCAATCTCAATGATATTTTGTACACCTTGCAGCACAAACTCTA
ACCGTATTGCTGCTGTTAGCACTGTATCCAACTTCTTCATAGTGTGCTAAGACAGTAGTTCTCCTAGCACACTCTCGCCAATCACCTGACTAACCTCGCA
TCGTAGCAACACGTTTGCAAGCGCCACTGCTGTTAATAGTGTACTACCACCTGAGCGAACTGACGAGTGGTGATGAATCAGTGATGATACCGTCCAAGAT
GCACACGATGCTCGAGGGAACGATTATGTCGTTTTCTGTGCTACATAATCCTAGAATTCCATACGGAAAGCGATAACAAGCGAAGCATCTCGCTCATACG
TCGGAAAACACTCGACGCGAACGGGTAGAGGAGCGCATCCAATTGCTGAAAAACGGATGGGCACTCTCGTCACCGATGGAACAGTCAGAAATGTACTAGT
ATATAATACGCAGTCTCCCGAGCAGGAATGAGTCGTATAGAAATTAGTAACCTCAGTCACACGCAGTTACTGGCACCACGGAGCAAATCTTTCTCCGACA
AGCGACACGTCATCATTGTACGCGGTACATATATACTTGCGTGTGTGGTACGTTTCATCGAGGCGTGCTTGGACGTATCCGTCCGCTTCCGCTGGAACGT
TGCTGTTGTTGTTCTAGCTGCCCGGGTCACATTATGAAGTGCGTGAGGAAACATACTTCGTTTTAGACTCGTGCCAACCTCACGACCTATGTGATAGCCT
TTTCTAGACACCATCCCATCCAGTGATCCATATTTGGCCTCCATAAACGGGAACTTAGAAGTGACCTGTACCGCGTAGCACTTCAATGGCCATTTATGTC
CATCTCAAAGATAAAACACCGGATGCGCGCGTAGAACGACCGGTGGTGGCAATCCAGGCTGTCTTATGCTGCGTAAGACAGTCTGGATGCGTAAGCTGCT
TAGACTTTATAAAGAATAAACAATCACTTGTTTCAGTTCATGTCAACTTCTCTAGCCCGCTTTCCCCACTAAATGGATTCTAGGTATAGGTAGTGTACTG
TGGTAATAACAATAATAAATGAGTACACAGACGAACAGCAAATCACTTGCACGAAAGGAAGCGCAAACTCAGTCATTCTCGATTTCGACAGCCAGGGGTG
ACTTGTTTCATCGCATCGATGATGTGGTCGCCGATACTGCATGCTTTCGTTTGCACCCTGCTCATGTTCGTTTGTGGAGCACTGGCCGACGACTCCGTTC
AACTGAGCGAAAGTTTCGGTGGTCCTCACGGCAACGAGTTCTCGGACCAGCCATCCGTGTCCGCGGGACAAATAATCAGCTCCCTCACTCTCCACGTCGG
AGAGCGCTGCCACGGCATCGAGCTCCAGGTCGCAGAACCTGCACCGCAAACTTTCGTTCATGGCGGACCCGGTGGGACCCTCAACACCCTCACTCTAAAC
CCAGCAGAATACATCACGTCTATGGAGGCTCACTGGGGCAAGCACAAAGGCCGCACGCGCATCTTCTACTTGAGTTTCGGCACCAGCGCAGGGAACTCGG
TCTCTGGTGGATCGATGACAGATGACAAGAACACGGTGACAGCACCCGAAGGGTTTCAATTGGGCGGTTTCTTCGGTCAAGATGGCGGCGAACTCGACCT
GCTGGGTGCAATTTGGACAAGAATCGAGGCCGCTACACCACCACCGCCAGTCGAGTCGCCAGCCACGGTAGTTCCAGCGGATACAGCGTCTCAGGGCGAA
ACGACAGCACCAGCAAGTGCTACGATAGCACCAGCAAGTGCTACGACAGCACCAGCAAGCGCTACGACAGTTGTCAAACGAGCGACTCAGCTGAGTGAAG
GCTTCGGAGGTCCTCATGGCAACCAGTTCTCCGATATAGCATCAGTGGCCTCCGGACAAGTAGTTGGGTCATTAACACTACATGTCGGAGAGCGCTGCCA
CGGTCTGGAACTTCAAATTACGGGACCAACCGCGGCAACATTTGCACACGGCGGCGAGGGAGGGACCTACAACACGCTGACGCTGGGTGCAGGCGAGTAT
ATTACGTCAATGGAAGCGCACTGGGGAACTAAAAAAGGTCACACGCGCATATTCTACCTGAACTTCGGCACCAGTGCTGGAAATTCGGTATCTGGAGGAT
CAATGACGGACCTGAAGAGCAGTACGACAGCCCCCGAGGGGTATCAACTAGGAGGGTTCTTTGGTCGAGACGGCGACGAGCTTGATTATCTGGGTGTGAT
ATGGTCAAGCATTGCAGTGATCGAGGAACCGCCTGCAACTACCGTCTCCGAAGATATCCTGCTGAGCGAGGTCTTCGGTGGTCCTCACGGAATTGCGTTC
TCAGATATTCGCTCCGTCAAGTTGAGCCAGACGGTCAGTTCTCTCACGCTCCGTACCGGTGAGCGATGTCACGGGATCTCTCTCGGTATTTCGGCCCCGG
TGGACGATACTTTCTCACACGGTGGAGATGGAGGCACGGAGAACACATTAGTCTTAGCCCCAGGAGAGTACATTACGTCGATGGAAGCTCACTGGGGGAA
GAAAAGTGGCCACACACGCATCTTCCATCTCAACTTTGGCACGAGTGCTGGCAATTCCATCTCCGGTGGAGGCACCACGGGTGATATGAAAACAATCACG
GCCCCCGAAGGTTTCCAATTGAGCGGGTTCCATGGCCGCTCGGAGTCCGAGATTGACCAGCTTGGTGTGATCTGGACTCGAATTGGGGCCACCGATCTAT
TGCTCACGGATAAACCTGACACTGGAGTTGCTACATTTGGGAGCTCAATTCGGAATTGGGTCGGCCCGAAGGTTGGAAACCCGAGCGATACCGCATGCTA
CCGGAAATCGGTAGGTTTCGGCAGTGGCCAGGTCTGCCCAATAGGCTACGGCAACGACGACGATGACTGCTTAGCGCAGTGCCCGTTATCATATCCTGTG
AGATGTTTCGCGGAGTGCATTCCTCAAAATGACGACTGTGCTCTCGAGATTATCTGGAAAGTTGGCTCCGTCGTGGCTGTGGCGTTTAATATCGCCACTT
TGAACGTGTTTGGAGAAATTCTAGCTGCCTACAAAACTGCCAAGTGGGCCATCACGTGCGCCGCCAACGTCATCTCGGTGGTGCGGTCTCTCATTTTCTA
TATCCGCTACCAGCAAACCACAGCGCCCCAAGGAGACACAGAGGAGCTGCTGGCGGTGGCTTACCAGTCTGATGTCGTGCTGATTGATTTGCCTGTCGCC
GTGTGTGCTTGCCTTGGCCTGCCTGTCCCGAAGAAGGCCCAGTATATCGACATGGTGGTGACGGTCGTAGAAGGCATCGTGAAGCAAGCCATCACAAATG
GTGATGAAATCCTGTCGACGGGGGGGAATGTGCTGAACATGCTCACAGGTAGTGGTGCACTGAACGATTCGTCTACGACGACGGACGAACTTCAGGACCT
CATCGATAAGAATTCAACGTGTGGCTGGGAGCTCAAGCGTCTCGCAGATCGCGTCGTCTACGCTGTCAACGACGTTCGCAATGACACACCCAACGCTGCC
GTCAATGACATTCGAGTGACGGTGTACAAGTCCCCCACTGTGCTAAATGACATTCCTGCGGTTACCAACAACTGTATGGCCGAGTTGCTAACCACGAAGA
CCATCTCGGCAGCCTACGAGACGCGTGATCTACTCCGGAGAACGTTCAGTGTGATTATTGACCAGCTGATTGAGAAGGCTACGACAGATATGGGGGCATC
CGTCGCGGAAGACGAGTATTTGCTCGAAGTCTCGAACATGGGCCTCGTCGTGCTCTCAACGGTCGACCCCACAGGGATCGCGTACTTGGCGTCTCAATTC
GTGCAGCCCATTTGTGGACCCACCGCCTACCTTGGCGAGATCGACGATGGCACTCTATACGATGCGCTGGGTCTCATGACTGTGGATGAGGCGTTCGAAG
GTAGTTACGGATCGTGGACCAAGGCGGGTGACGGAGTCGTTCGTCTTATCTTTGAAAGCACGGATAAGGAGGATGTGACGGTGGTCATTCATACGGGTGG
AGAAGACTATGCCGAAGTGGACGTCGGCGCAGGTGAGACGGTGGTTTGGGACTCCACCGTCCCTGAGCTACAAGACAAGAACATGTACCTCGATCGGTGG
CGGCCTGGCTTGCTCGGCTTGCCAGGCTCAGGTGGCGGGTCATTGCTGCTGTGGATCCCGCGTGCGGCGGACGGTGGCCACATCACTATGCACGTACGGA
TCAATGTCAGCTAGAAGCATGTCGACAATTACCCCGACATTATGCAGTGTTTTAACCACAAAAATAAATGTGCAAGTGCAAAATATCGTAGCTAACCAAA
AATTGGTTTCAAGATTTGGCTGTCGTCTGATTTTCGGCCAATCAGCGTTCCTCCAACATTCAAATTATCGCGCGTTCCAGTCCCCAAAAAGCGGCCGCAG
CAGCAGCATTCGACATGAGCGAGGGACGTCTGCAGCACCTGCTGCAGCCCATTCGGTGCGTGCTCTCTCTCTCATCCTCTTCTGCATCGTCTCCTCCCTC
TTCTGACCTATTTCCTGCTCTCTAATTTCCTCAGGGACCTGAGCAAGAACTGGAACATCGACTTGGCCTCCGAGTTGGAGGAATACATGGACAAACTCGA
GAACTTGAGCATCGCGTTCGACCCAGAGGACGGCGCCAGCATCGACAGAGACGGGGACAGCGTCATGAACTTCGCCGAGGCCGCGCTGCTCATCCAGGGC
ACGAGCGTCATCTACAGCCGCAAAGTCGAGTACCTGCACGCGCTCGTGTTCCAGACGCTCGCGCATTTGTCCAAGCAGCAGGACGACAAGCCGCAGAATC
AGCAGAACGGGGAGCCAATAGACGGACAGGACGAGGAGGAGAATGATGACGCAGAGGCCGGCGCGTTCAACAACCCACTGCCGCTCTACGACGAGCTACA
GGAGGCCAAAGCTGCGCACATTACGCTGAAACAGGTGACGCAGCAGGACGAGGAGACGGAGACTGATAGGAGGAGGAAGAGGAAGGAGGCGCGGGCACTT
AACAGGAGCAAAAACAACATGCAGGCGTCCATTGCGCTCATGGGCTCGCTCGTGCCAGATGAACGGAGACACAGAGAGTAGTAATACTTAGCACATTACG
CCGGCAGTTTTTTTTCTTAGCATCTTTTTACACGGAGAGTAGGTTTAATCGTTTCTAATACCCAGCTGGTGTTTCTAACCAACCAATCCATAACCTCAGA
GCGTAAGGAGTCATTTAACTTATATTAACCAGGTCTGAGAAGCGTTAACCTTTGTATCAGTTCCTGCAACTAATGTGACCACACCATTTTACGGCTTAAG
TACGAGTGCAAAATTTCTCCCTCCCTTCTCTCTAAGAAAAAAGAGATGGCGCGGAAAGTGTGGTTCCAGCTAGTGGATGCAGCAACTCACGGTCCGTTCT
TGGACCACAAGGCATCATCAGTGCCATGTGATAGTGTCAACGATATGGAGGATCTTCGCAACAAGATTCACGTGAAGTATGACCACACGCGACCGCAAGG
AACGGATATTCTGGCTCAGCTTACAGCCGATCAATTGGATGTCTACGCCAACAGAGCAGCATACGACGACGAGAATGCCCAGCCTTTGGATCCGAGGTCA
TTGTTGAATGATCTTGACGCGCAAGCGACGCTCATCGTGGAAGTGCCGACGCAGCATCTTGTTCCTCGCACTATGGCATCAGTGGTGGCTCCGGTGGGTG
GTGTATCAGGGGATAACGACGGACGAAGCATTCGGAAGTTCAACGAACCACTTGAGGATTCCGAGTTGGAACATGAAGGTGGAGTTCCTGCAACATTCAG
GACGTTGCGAAAAGCCACTGTGGCCGCATTTGCAAGTCTTCTCGATCGCATACCAGTGATATTCATCCGCGCTCCCCCTTTGTCCGGCAAGACGGCCATG
TGTGATCTACTCTACAATCACATTGTTCGCTCCAAGCCTGATGCGCTTGTTTCACGCATTCGGGCAAACAGAATGACTGAAGATGGCAAGTTTGCTGAGT
TTTTCAAGCTGTTGTACGGCTGTGATTTTGAAGCATTCTGCGCACACAAAGGCGATCGGGTGGTCCTGATTGATGAAGCCCAAATTACGTATAATGACGA
GCAGCTCTGGAGGGGATACGTGAAAGACGCATTGGACTCGCAAATACCAGGCCTACGCTTCGTTCTCTTTTCGTCGTATGGCAGCTTTAATGTTTACCGC
AAACACGAACGCGCTGGAACTCCGATCCTTGTGCCTCCTCAGAATATTTTTGGATTGAATGCGACACCATACAAGCCTGGCCTGCAGCTTTCACGTGAGG
AACTGGAAGAAATGGCTCAAAACAGCATTGGCATATCAGCCTCCGATCTCATCTGGATCTTGTGCTCGGGTCATATCGGAATTGCTCGAGCTATCCTCAT
CTTTTTGCATCGTAAGTTTGGTTCTGGAACGCCAAACGATGAAGATGTTGAGCTGGAACTTCGCTCCTTGGGGCTGCTGCAAGAAATTCGCTTCAGTTAT
CGGGGTATCCCGAGTGCTGATGCTTTCCAGCGAGTGAAAACTGCTAATAAGCTGCCGGATGAAGCAGTGCTGAAGATGATTGGAATCTTGAATGGTGTTG
CTTCTGGCAAGGTTATGCTTGTATCCGATGGACAGCGAACTCCTAGAAGCCAGATTGCCGTGGAATTGTTGACAAAGTACGGGTTCTTGTATGAGGATCA
GGCGAAGCAGCTTCAGTTCGCTTCAAGCATGCACCTCAAGATCTGGCTGTATTCAAATCGAACAGATCCAATTGCGTACATAGTATCAGATGTCTCTCAC
GAAGACTTTGTTGTCGCGTGCGTGCAGCGAATGAGTGCTTTGCGACTGCAGAACTTCGCGAACGAAAATACCAACGGCATTGCTCGGGAACGCCAAATTC
AGATGGAGCTATACGGCGCCACAGTATCATGCTTGCCTCGACATGTGTTGGTTACCCCAGAATGGCGAACGACTGATGGCAAAGGATACATTGATTTAAT
GATTCGTGGCTCGAGCATTCTTTGGTTTTGGGAGTTGCTAGTGAATGGTGATGATGCTGTCGGCCATTCAAATCGATTTGAAACTGGGGGGAAGTACCAT
GGAAGCCTAACTGGAAGTTCTAAATATGTGCTCATCGATTTTCGTCAGAGTAAGGGCGTTCGGCATCAGAAGCATGGGTTTCTGTATGTGTCGTTTGTGG
ATTCTTACACCAAAGCGCTGGTTTTCAGCACTGGTAAGTCCGTTGTAAGTGTCAAACTGTTAAGCTAATTAATTGTTCACGTTTAATACACGACGTTGAG
GTGTATTATCATTGAATAGACAAAAAAATTAAAGCTATATGAAAGATTGGGATCATTGATGTTTTTATTATCCTAACAAATATAAAGTTATTAATATACA
AAGATGACGTACTCTCCCGAGCAATACCTGGCTAACATAGAGCGCATCAAAGAGGCGCAGAAGCGCTACTACCAGCGCACACGTGAAGCTCGCTTAGGCT
ACCAAAAGGGGTATGACGATAAGAATAGAGATCAGATTCGTACTCGCAAGCGGAAACCAAAAATCAAACCTAATTCAAGCGATAGCGAACCTAACACCGA
AAGCGAACTTAGCTAATTAATTAGCTTTTTTTATAAAAAGTCAAGCTATATATAGGCGAAGCATGAGCACACCTACACCTTCTGAATTAATTAATTAAAA
CTAAAAAAACTTTCTATGGGACCATGATATAAAGTCAATCCTGGTACATCCAATAATTATAAAGTCATCTCCACGAGAATAATAAAGCCACAAATATATA
GCAAACATGCTGCCTTACGAACGTGAAGGACTAAAATGATTAAATATTAATGTAGTCCGATGGGGTACCGATTATCGCGTCAAGGTCCGAGGTAAAACCG
GTAAGATGGTTTATGTTAGCAACATCACTCGTCTGATCAATCAAAAGCTGGTCGCAAAGCAGTACAATGTTTCTATCGAAGACTTGACGAAGCATATATC
CAAGTACTATATGACCGACCCCAAATATCGTTTCTATAGCGGTCAGCACATGGAGTCTCATCTATACGAAGGTATCCAACCATCGGAGTTCTACGATAAG
CTTGAGCACGTTCTCTTGACGCAAACCAATGCGTTCAAGGTGAACGTTGCTCTCGGCTACGACCTGATTAGTCTCAGCGATGAGAATGAAACCAGGTACT
TTCACCCGAATCTAGGTAATACCTACGTATTTAATACTCCTGTTGCGGTCAATAGTAAGGCTGACATTGGAAAGAAAATTATTTCAGAAATCAGGTCTAT
GGCGCTGGCTAACAAGCTTAACTACCCCAGCTCCGGATACAAGGTCAAGGCGATTACTGGCTTTAAGATTTTCATCTACCATCGCAACCATGCTCTTGGT
GATAGCGAAGCTGTCATTCCTAAGGTTATTCGTGAAAACAAGCATGTCATCAACTTTCCCAAGACGAACAACAAATGAGTTTTCCATTACATTACATGGC
ACTTGCTACAAGACCCTAAGAAGGACCCTCGGAGAATTCAGGCTCAAATGAAGGAGGTATTCAAGCGATACTGTTCTTTCAAGGGTATTATCTATACTCT
GAGTCTATTCCGAAGCTTTAAGCGTATTGACCTTCTACAATTCGATGAGCTTGAGGACTGCTTCCGACTCGCTCTCAATGTTTATACAATGAATGTGGAA
TCGGGCAAAGTTGAATGCATTCGTCGCTCGGACAAGGAGTTTGAATCCATGGCCATCCTATCTCATGAGAACCACGCTCTGTATATTAAGAGCACCGATA
TGCTTCAAAGCAAGTATCAATACCCTAAGTGTGAAATGGTCTTCGTTAGCGCTGACAAGCTTAAAAATCATAAGCGGAATCGATGTGAGCTTGTGAATAT
TGAGAGCTTCCCAGCGGAGCCAACTATCTACAGACCGCCTCAGAATTCCATCAGATCAATGCTGACGAAATACTCTATTAAGCGCTTGCCGGCGAGGTCT
TCGAGCTTTCTGTTCTTCTCCTTGGCCCCTTCTCGGATGCCCTGCAGCTGCAACTTGAGCCGTTCGAGCGTCTGCGTGGACTTGGCCGACGACGTCAAGA
ACGGCACCTTGGTCTCCGTCCTGGACAGCACCTGCTTGGACCAGCCAGCGCCTTAAGGTTCTCCTCTCGAGCTGCGACGGTCGATGATCGTTTTCGTTCG
GGACGATGTGGGCTAAGCTTGTCCATGAGAGCACGAACCATCTTCCAGTTTTTTTTAAGTAGGGCTAACGCTACGAGAACTTACGAGCCAGCGAACATAT
GGATCACTACATCGATCACTTCATTGTGTATGATTTTGAGGCCATACTTAAGCCGACCGGTATCCAGCACGGTGTAAGCACTATCTTCACGAATGAACAC
GTTCCTGTTTCGGTATCAGTAGCTGACGGTCTCTCCGGAGAAGTAAGATGCTTCGTAAATGATGAACCGAAAGCTTTGCTAAAAGATATGTTTGATTACA
TTAGCAAAGTCGGCTTGAAGATTCAGGAGTACAATGTTCAAAAGTATGAGCCACTTCTCAAGAAGATTATCAAAGCTCACGGCTTTAGTGATATGGAGAT
TCCTGGCTTAAAGCTTGGAAAGAAGTACTCACTGGATGACGTTGATAGCTGGATCAAGGATGGAGATTATGCTACTTTCTTCGATTTCCATAAAACAATT
TCCTTCGGGAAGGAGAGGTCTGATTACGGGAAAATCAAGCAACAGCTCGATCAAGTACTAGTGTTGGGGTTCAACTCTGGTAGATACGATATCAACTTGA
TTAAGAGGACCTATTTCCTGTCATTGGTACGACGAACATCAAATCGGTTATCAAGAATCCAAGCTACATGTGCATTGCTACTTCCGATATGAAGATGCTT
GATATTAGCAACTACGTCCCTGCTGGAACAAGCTATGATAAGTATCTTAGTACATATCTCGGTGGATGCATGTGTGATGCCAAGATTCAATGCGTATGTG
GTCTTGGCAAGGGGCTATTTCCATACGAGTACATCAAAGCTTTCGAGGTGCTCAACGAAACCAACATCCCCCCTAAATCAGCATTCGACAGTGCTCTTCG
TGGTACCAGCATTAACAACGCTGATTATGAGCGGATAAGGTTCGTGTGGAAGCACCATGAGATGAAGTCTATCAAAGATTTACTCATCTGGTACAATAAC
TTAGATGTAGTACCATTCATCAAGGCTATCGAGGCTCAGCGTGAGTTATTTAAGCGTTTTGATCTCGACATGTTCGCTGATGGGGTCTCGCTTCCGGGCC
TCTCGGAGAAGGTTATGTATTAAACTTGCTTTAGCGAGCTCCAACATCCTGTTAAAGCACCTGCTATATCTTTCAGATTCCCAGCTAAGCGTCTGGCTGG
CTACAAGCATCAGGATGTAGATGCCAAGCGTGAGTTCAATATGACTCTTGATCACTTGGACACATTGCTGAAAAAGCAAAAATATTTGTGTGGTCTGTGC
TGGTGTCAGCTGACTGTCGATACTGCATCAGCCGATCGTATAAATAACAATTTGGGGCATATTGACGGTAATGGCCTCATCTCATGCGTCCAATGCAACG
TCGCCCGTAAGAACATGTCGCTCGGTGGATTTCACTTCAAGAAGCTGCTGGAGTTTAACTCAGACAAGCTTGTATATTCGATTGACAGGGAGGAGAAGGA
TATCTACGGCAAAATGAAGGAGAACATTGCTGGCGGGCCATCAATCATCTTCAATCGCTACGCTAAGCGCAACGAGACGAAGATTCGTGGTGGTAAGCTC
GTGAAAAAGATCATCGGCTACGACGCCAATGGTCTATACCTCTGGGCTCTCGGTAATTACATGCCTTGCGGACGCCTTACCACTATTGAATCCTATCCAA
ATATTGTTGAGGTATCAAGAGCGACAATATCTTTGGCTTTCTTGAGTGTAATATTCGAACTCCAGACCATCTGAAAGAGTATTTTGGTGAAATAACTCCC
ATTTTCAAAAATATATTGATCGACTGTACTAACGAGAAGGTCATTGGTGATCATATGTTTGAGTACAATGAGGCGCGAGAAAAGAATAAAGCTAAGCCTG
CTCGCAAGCTGATTGGAAGCTACTTTGGAGAGAAAAAATTCAGATCTACACTCCGCTACTCAAGTGGTATCTGTCTCATGGAATTGAAATCACTAAGACT
TACAGCTTTATTAAAGCCAGCGCTCACAAGGCTTTTGCTCCATTTATGAATGCTATATCGAGTGCACGTCGTGTTGGTGATGAGGATAAGAGTAAGGCTA
TGATTGCTGAGATGATGAAATTGGTTGGCAACTCGGCGTTTGGTCGATCAGGCATGGACATGAGCAAACACAAACAGGTCAAGTATGCGTCAAATGAGGA
TAAGATCAAGTCGCGTATTGAGCACTTCACGTTTCATGGGTTAGAGGAGCTGAACGATTCATGTGAGATAACCATGAAAAAGCGTCGTCTTAATAACAAG
AACCCGATCCATTTGTCTATTGCTATCTATCAGCTTGCTAAGCTACGCATGCTCGAGTTCTACTACGACTGCATTGACTTCTACTTCGATCGATCCGACT
TCCAGTATCAAGAGATGGACACGGACTCTGCCTACATCGCTTTCAGCTGTACAAATTCATTCCAGGAGTGCGTCAAACTTGAGCTACGTGATCATTTCAA
ACAGCACAAGTACGATTGGTTTCCGTGCGACTATAACACGGAAGTAGCTAAGTTTCATCGTCGTACCCGTGGCCTATTCAAGGATGAATGGTCAGGTGAT
GCCATGGTCTCGCTCTCGAGTAAGAACTATATTTGCTATCTTCCAGACGAGTCATACAAGGTGAAGGTCTCAGCTAAAGGCGTACAACAAAGTCGTGGTT
GCAATGAGGATGTGCTCAACCCTTTGGGGTTTGAGTCAGTAGTTCGCGACCGCATCACCCTTCGAGGTACCAACAAGGGATTTAGACTATCAAAAGAAAC
TAAATCAATAATCACATACAGTCATACCAAAACTGCCTTATCGTATTTCTACGACAAGCGACAGGTGCTTGAGGATGGAATTAGTATCCTCCCACTTGAT
ATTTAGATGTTCTCCAACCTATCACATGTTTTTTCTTTGAATATTATATATGAATCATGGACAGGATGAGGGTGAGGTCGCTGACCACACGCACAAGTAC
GAGCGAACAGCTCGATGATCTCCTCCGCAAACTCTACTACAACCCGAAAACTGGTTATATTGGAGCTCAAGCGCTGTATCAGAAGGCTCGAGAAAAAAAT
CCTAAAATAACGTTAAGGAATGTCAAGGATTGGTATGCTACTCAGTCAGATATTCAGCGATTTCAAGAACAAAAGAAGAGCTTTGATGGGTTCAAGATTG
CCTCTCATAACCCCAACTCCTGGCAAATAGATCTTGCATTCTGGGGAAATCAACCGATTTTGACTGGTGTCAATATCAACTCCCGCATCGGGTACGCGAA
GGTTTTGGTGAATAAGACCGCGCCTATAGTTTTAAAGCTCTTCGAGCTCAAAAATCTGGTAAAGGAACGCGTTTAGCTATCACACACAAGGAGATCGTCT
ATCCATTTAAGCACATGCAAGGAGGAGGCATGCACGGGGCAAGCATATGGAGTAAGATTTGGGGAGGAATCAAATCCGCTTTCAAATTTGGCAAAGACTC
AGGGATACTGTCTCGTGTTGCTGATGTAGCTGTTCCCGCTCTTGCAACCGCACTCGGAGCTCCACAGGGTGCTATTCCAGCGAGAGCTGCTATCCGCTCT
ATGACTGGAATCGGTGTTTATGATAGCGATAGTGATACTAGTGATCTTGGGGGACGCCTGCCCATGGCTGATGTTGAGAAAGGAGCCAAACGTGCTCTCG
CTTACACGAAGCGTAAGGGGATTCTTACAGACGCTGTCGATGCTGGCGAGAAGTTTCTCCTGAGCAAGGCAACGAAACCGGAGCACGGTGATCTGATCAA
GACACTTCGCGGCGAAGTCCGTCGTCGTTATGGAGTAGGCATTGTCAAGCCAAAGTCTAAGAGGTTTGCAAAGGGGTCCCAGGAGGCGAAGGATCACATG
GCAAAGATACGCGCTATGAAGAAGTCTGGAGGATCCTTTAGAATGTGATTTCAGTAGAGAAAAAAGCTAAATGAAGAAGTTTATTTTTTTGGTCGAAGCA
AGAGCATGATCGATACTGAAGTATCGCGGAATTTAATTTTCTGATCATTTTGGTTGTAGATACTGATAGTAATTGTAGATCGCGAACCATTATGACAATT
CATCCATGCATACTGTGATGGCTAATAGTTGATCAGCTGACCAATACCAGCATCACCTCTATCAAAGGCACTAAGGATATACTCGTTTTTGATTAAATCA
CAGCGAACAATGTATGAACTGGTTGGGTGGATCTGTGGGATGATATTGGATAGCTGAGCACTTGCCACTGTCGCTGAGGTAGCAGGGTGCGTAGCTGTAG
TTAGTCCAAGTACTGACCCAAATGCAGCATTATTGATGATTAAACGCGGAACGCGAGTTGTAGTAGGCAATCCACTACCACCAGCTGAGTATAAACCAGT
GCCAGGCCTCGTGTATCCAGCTGGAAGACTCGAGGGAGTCGGAGAGAAATCGACCTGAGCTGCGTAATAGACACTGTTCTCAGTAAGTTTGATATAGAAA
ACATTGTTTCCAGAGCCGTCGATGAGATAGGCACCTGCGTTAACAATAGCTGTCTGGATACTTCTGTTGATATCATCGTAGCTGTAATATCCATCTAGTA
GTGTAATACTAATCGTAGAATTGGTTCCAACCGTCGGAACCTCCACTTGAAAGGTCGTGTTCTGGAATTGAATAGAATCAATGTTGTACTCGCTGTTGAA
CAGACTGGTTGATTGAATAGCGCAAACAACATCGCGAAAGTCAGCTGCCGATCCCGGAAACTGATATTTCCACGACGAGTTGTATCCATCTGCTACGAGG
TTGGTGCTATCGATTTTCAAGAAACTCGCCATGATGACTATATAATTATTGACAAACTTTGGATTAATTTTATTCATAATCTTCAGTCGTGATTGGCATA
TCGAAATTGTATCTGATTTCGCCCTTAACAGAATCGATGAGCAACATCTGACCTTTTCTTTCAGTTGCCTTACTATAGTAATAGACTATTGAGCGATCAT
CTACACCCTTAATATTAAAATCTTTAACAACCATCTGCAAATCCCGCTTTGAATTAGCCTTTAGGATTGCTACATACTCGGAGTTTAAGCGTATCATCTT
ATCGGTTGCAAAGTAGCTGTGGCTTAGGAATATAGTTGATAACTTGAAATGACGTCCGCAAGTAAAATAATGGGAAAATATATTCTTCTGGAGTAGCTTG
TCGTTGCTGTAGTCGTCTATGATTATAAGCTCAGGTTTGTTAGAGCTCATGGGTGTATGACGTACTTGATCAACTTTCGGAGGTAAATCTGGGTCAGCAA
AAGTAATGAAATCTTCAAGCTTCTCGCGAAGGTACTCATACAGTTCTTGATGAGGATTACGAGCTATAACCGTTAAATGAGCGAATACGTGGGGAGAATG
CTTGAGGATAAACATACATAAATTGTTCTTTCCACTGAATGAGGGTCCAAGAACAACCATTCTAAATAGCTTTTTAATGTCAAGCGAAGTAATATCACCC
ATACCGACAGACTTGAACTTTTTCGGCAGCGAAGCGCCATAGTTTGGAATAGCGCTCATGGTCGTGTCTTTTAATCACTGAATCTATATAGATTGAGACA
AAACAAACATGAGTTCTGGTTTCGCGATTCCTCAACCAATATTCATATCACCGATTTACAATCCTGAATTCTATCTGTCGTTAGACGCCAATGGTTATCT
TACTTACGAATATGCACAGACTCTATATATTAGAAAGAACGATTACCGACTTACATACATCACCGGTATTACACCTGGAACAGCAACACAAGGAATATCT
CTTGTTCCAGGTACTAACAATGATATCAGTGGCATTGGAACACTATCTTGCACTAACCTGATTATGAATGGATCCGCCGTCTTGTCTGCTCCTGATTACG
TAATGAGCATAACTCCAGGTACAGCTGCTAATCAAAAAGCATTGGTACTTGACAGCGCAGGAGCTATTGCTACTATCAGCTCGCTCACGGCTACCAACAT
TTACGGAGGTATCAAAACGGCAGCTCAGCCATCAATTACATCTGTTGGTACTCTCTCTTCGCTGACGCTGGCTACAGCTGGAACAGGCTTACAGATATTG
TCGCTGAAGTTTTGGGATGGTGTATCGGCTTACACTACATTTAATCAGACGTACTACCTCGGCATAACAGAGGGCGGTGCTACTGGTTCTAAGGCAATGA
TTCTCAATTCAACGAAAGACTTTTCAGGTGTTAATTCATTCTCAGCTGCCACCATCAATGGCACCACGAAGACTTCTGGCACGATTGGTGATTTCGGATC
GCTTCAAATAGGTTCCACGACAGTGATATCACTAAGTCACAATATTTCAAATATTGGTACGATATCGGCAACATCGCTTTCAGGTACTCTTCAGACTGCC
TCCCAGCCAAATATAACGAGTGTTGGTACGCTAGCTTCTCTAAGCGTATCTGGCAACATCATTTCGAGGGGGTTGCTCAATGGATTCTTGGGATACGGCA
ACCAACCTTACATAACGACGGTGGGTAGTCTGACAGAGCTTGGTATAAACAGTACTCCAACGACTGAGTATTTTCAAATCAAAGGTAGCGGGCTTGATTA
CCTTGATGGCTCATATACCAGGATGTGTCGATTCGTCGGATCAAACATAACGCCATGCGAGCTCCAATTAGAGGTATCTAATGGATCTGCTGGAACTTCT
ACAAACGCATAATATATAGGTAATATTTTGGCAACTGATCTCCGATTCGGCACAGGTAATACTACTCAAATGATTTTGACCGCCGGGGGCCGATTCGGGA
TCGGTACGACCTCTCCTTCCTGTCCATTCAATGTTCCTGGCGTAGTCTCTTTCACGTTCGGGACGGGTGGTAGTACGGTCTACAGACTGAGGACTGACTC
AGGAGTGGCCGAGAGCGCTCTAGGTCCTATAGGCTATAGCGTCAGTGCTGTGTTCGGAGTCTACATAACTTGCACTTCAATGGCTATGACATCAGACAGA
CACCTTAAGAAGAATATTCAGATTGCACCTCTTGATCGTATCAAACGGCTGTACGATACCATTGATGTCTGCTTATACGATTGGATTGAATCGGAGAATC
GTCCGGGTCAGGAGGTCGGAGTCTTAACCCAAGATCTCGTCTTGGCTCATTTGACTGATTTGGTGTCCGTTTTCTATAGAGATGATATCGAAGAGGGACC
CGACCCATCGCTTGAGCCGGCAAAACAGCAACTCAACGTTGATTATAGTCGTATAGCTGCATACAATATGAAGATGATTCAGTACTTAGTTAAAGAGATT
GAGGATCTGCGAGCGGTTACAAGATAAGCTTCGCGATGATAGAAATGTACAGCTGTAATTTCTTTGGAGCTAATATAATCATGGGTTGCGGACCGAGTAA
AGACCTCAGAACAAATTTGACTACCGATGAACCAAGTCAAATCATTGGCTCGACTTTATTGAAAGCGGATCATATCATAGTTTTAGGTGATAGCGTGTTT
CTCCCTACACAGAGTCCTAATGGTGAATCTGCAATACTTGAGATTAGTATCAGTGATAAAAAAACGTTTATCGTGGATATCAAAATAAACTCATGAGAAA
TGGAATAAGTTAGATGGGAAACGTTTTTACAGTTTTTATTTTTTTTCTTTGGTTGGTAAGTCCATACTACGCCACCCTGCGTCTGAGTCGATGCATCCAC
CTTCTTGTTAGTTTTATTTAAATCAGTTGCCCACACTGCTGCCTGTGTCTTTTGAGGTCGATCGTTGATGATTAGGTTCTTCATGATAGCTTTTAGCTCA
GCAACATTGAGGTCAGCGTTATCACCATAGCTGCCACCAGAACTTGAAATAATGCGCGGATTGAAGAAAAACATTATCTCTGACTATAGTAGGCGAGTGA
TAATATCTCTAAATTCGTTATCATTGATAAGTTGATTGCTGTACATATCTACAATGAGAGACTTTAGCTGCTTTATGATGCTTGGAGCATCGTTGCCTAA
TTCAAGCTCTCCTTTTAGCTAATCATACTCGGCTCGTAGAGTCTGAAGTGGGTCCTCGAGCTTATCGTGGAAATTATACTGGAGATGGGTGATGGCAAGG
ATCTCCTTGAACAGTTTTTTGTCCTCGATGCTGAGCTTATCTTAAGCAGATTGGTCAATGTTTTGTTTATATACAAGAGTTCTGATCATGATTTGAAGAC
TATCACTAATCTGGCGTTTAGGACCGCATTTCCGACGGTTAGGCTGAACAATTACGAGTGTTTTGGCATCCAGATCTGGCAAACGAATGTACTTGCTACC
AAGCTGGCGATACACATACGCACTAGGTGTTGCTAACCCCTGAATTTCATTCAGGTTGTAGGTTCTACCGCGTCTGACTACTCCATCCAATGGAACTAAA
CCAGCGCCTCTTAGACCACGACCCTCTAATTTAGGGCGAGCGTCCGAATATCGCTTAGCTTTAGAATTATATACAGACTTCGTAGCTTTAAGTGCTGATT
GTGTGGCTTTCAAAGCTGATCTTAATGCTTTAGAGTTTGAGCCTTTCACAGCTTCCTTAGCTGCTTCATATCGCTTCTGAGCCTCTCCATATGCTTGAAA
AGCTGTCTCTGCATCATCATGAATCTTCTGCAGGACTTCGTCGTGATCATATGGCTCATCACTTTGCTTTTTCACATCAGATGCGTTGCTGAAAATGACA
TCTCGAATAATCTTGAGATTAGCATTTACATTCTCTACCATTTTCAGCTCATCTTTTGTAGCTGGGGCTTCAATATTGCTCGCAGTCTCTTGTGCAACTT
CCAACTCACTAAGCAGAAATAGAAAGGTATCCATCCATCGAATATTTCTGAGTAAACCAGTCAATGCCTTTCCAGAAACAACCTTATGGTCCGAGTTTCT
TAGTTTTAAAAATTGTTTCTCACCTGGAGAACCGAAATAGTACGTATCGTGAGCTCTGAAACCGTCTTTGTAATTTACAATCGGTCGGAGGCGAAGTGGA
ATTTGAATCCCGTCATCGAAGAGACGCTTGTAGTACTCGGACAAAATAATTTTAGCCTCACTGTCTGGGATTGACATCGTATGATCCCTGTCTTCATCTA
ATCCAGTTTTGATATCACGACGTGCTTCTCGATCATAATCATCACCAGTTGCCTCATATGATTTAATAGACCTCTCGGCATCACTTGCTCCTACCATTGA
GATATTTAACCCTCTGCTCTTTATCATTTCTAAGAATGCTCTTAGAGTCGATTGCCAATCAACCTTGTTGATTGCTGATTTATGCTTCAGGTTTGAATCT
CTCCCATACACATCGATAGACCCCATTTTAATCCAAACATATTGTTTCAAGCCGTTTTCATCAGATTTGAACTTCTGCTTGAAGATCGGAGTGATGCTTT
TTTCAATCCATTAGATTCCAGCATATCCTGATTCTTTACTACAATCCAAAGCAGCTTTAATCGACTTTGCTCGTTATCATATGTTGTCGATGTAAATTTC
CGACTGAATCGGATATCAGGTAGTCTCCGATCCTTAAGAACAACATCGAGATCCTCTAAATCATCGCCTGCTCGCTTCTTCTTCTCCAATCGCGTTAGTG
TTCGCGCTCGATCTTCTTCGCCACGCATGGCTCCAACTTCATTGATTGAGTTGCTTTCACCATCGTACAAGACATCTCTGAGTTTTGATTCTGTAGCTAC
CCAATCAAATGATTCATAATTTTTGTTTTTCTTGCCATTTCTAACAGAAATTACAGATCCCTTTTCTCCCAGAAGGTATCTCGGATCGTCTTTACCACTT
TTCCTTCGAATAGGGTGGATTTGGAGCGCAACCCAGTTAGGATTTTCTCCAAATAGGTGTTTAATCCAAGACCTGGATTGCACTTGCTCTTCCGTATCAA
GCGGGCTTTCACGAACACTTTTAGTCGAAGTTGAAGCATTTATCATTTGTGGAGATTTATATGTTTCAACTCCAATATCAGCTGTATTGGGGCTTGCCTG
AACTCCTGTATGAGTAGTCATGAAGGTTGCCTGTAATTCTTTATTAGTTGTGCTGGGACGAGCCTGTAATCCACTATCAGCAGTTTCGGGACGAGCCTGT
GCTTCACTATCAACCATTTTAACTGTTGAGACCTCAGGGTTTGTCTGAGAGAATTTATCACTCATTTTTTTTTAATTGCTCAGACGAATCTGTCTGAGCT
GGTGTGGAGGTTTTTGAATTCATTGTGCTTACAGTGCTATCTACGTCGCTTGCCCATGATGCACCTTCATACATAACCCGCTTCGCTTTAGCTTGTTGGA
CACGTCGTTGAGATCGTTCGAGAAGATCTTGTCGCTTTTGCTCTCTCTGAGCGAGGGATGAGAACGAAGGAAACATTGTGCCTATATCCTGTGTATCATA
AAAAAATATAGGAAATTACCAGTAGCTCGGCATAACTGAATCATGACGAAATGTTGCATGTGAATGACATATATGGTTTCTTTCATTTAGTAAATTGAAA
TATCGATCTTTAATGGAATGAAACGGAACGCCAAAGATTGCTTCTAATTCACGCTGATACTTACGATTTACTACCGTTTTACGAAAATTTGATATTGCAT
CGAGATTCACCAACTCGTTCTTGATTCTGCTTACTTCCTGAATGATCCACAACTTTCGCCGTAGCTTACCAAGCTCACGGTTTTTTTGTAAGCAGTTCTG
GCACATTCCTATGGGTTAGTGTCTATATATCAAGTCAGATATTTACAAAAAAATCTTAATATAATAGTGGAAATAGTATACTTGAGTCAAAGCTACAGAG
GATGTCTCTATCAAATTTATTATCAAGCTAATTATGTCTCTTTTTTTTTTGCGTCAGCCAATACTCCTTTTCAAGAGTCGATTTTCTACTTTTATTAACT
AATCTGAGATTATCTTGCAGCTCCCAGGAATCAGGTTCATTTCCCAGCCACCGAATGAAGTATTTGAACTTACCAGTTCGCATCTTTTTATGATCTAAGA
TCTTCTCAGCTTCAAGGATATCGCCTCGATTGATTGTAGCCTCAGTGGTCTCTGATTGAACCTTCTTGAGGTTATTTGGAGCTTTGTAAAGCGTATGACC
ATTATTTGAGCGAATTTGGACTCGATAGCCATCAATTCCTACCACTGAATATACAGCCTTGCTCCAACGTGCAGCCTCCTTTTCAAACGTTCCCTTCTTG
AGCCGATAGATCACATTGATCCCAACGCTGAACTCGTTCTCAATCTTATCAGCTTCACCTTGGTTATGAGTCAAATCTGCCTCCATTACTCGGCCTTTGG
CTTCATTTGGCGTCATTCCAATCGATCGATGAACAGTGCTGTTGTAGTTGCCAATAACGTCGCTGATTAGCTTTTGCGTAATCCGTTTTGAGATGGAGCG
GGTGAAACCCCTCCCGGGCGACCATCGGTCAGCCACATCTTGGTTAGTCTCTGCTTTATAGTTCGGTTGAATCGTTTAATTTTACCCATAGTTCCATGAT
CACCTGGCTCGTTGTTGAAATGGTCGATCTTTTTGCCTTTGAAAAATTCCTGAGCTTGAGCATTCATGAATTCACTACCATTATCGCTCGTTAACATACG
ATTCAGGATGAAGATGAAGCGTAGCACCAGAGCCATTCAACTCATCTTTAGTCAAGGATAGAGTACCGGTCTTGAACGCTCGCTTGAGCTTTATCTCTGG
AACCGACGCTGAAACGGCTAATTCTTTGAATGCCATGATTATATTTCATGATTGATTTATTATTAAAGAATGGTTAAATTCAAGTCTTTGAATCGGCTCA
ATAGTCCAATCTTCCTGTTTTGTTTGCAATACAACCAGAGTATGCACCATATACCGCAATAGTGGATTGTACTTTCCAATTCCATACTTGGTAGGAGCTG
CTTCGCCCATACTGTCAAAGTATTCACCATTATCAACACAGGTCCAATGCCCTACATCAAGGTTAGGAGGCCTCAATAGTATCAAATAGGTTCCTTTCTT
CGAAATCGGTTTCAATATTTCATTTGATTCAAATATTCCGTCCAGATGTACTCCAATTCGATCTGCAAGCTCAATGAGATCGGGGTCACTGGTGATTGGC
TTAATGAGATCGCTCATAATAATTAATTTCAACGAAAGTATATTAGAAACCATATAGATTCAACAATGAGCGAAACTCAACTATCCGATCAGTATTTGTA
CCAGAGCTCGCTGCAAAGCGATCCGGAGATCAAGGTATCTTCTGGCAAACGCGTACCTTTTGTGATCGATCTGAATCAAGGCTCGTATCAGAACGGTGTT
ATCACTATCGATGCTACAGCTCAGCTAAACGGCTCTGAAGGATTTGCGTGTCTTCGCGATGCATACATCATGCTCCCATACAAGGTCTCGATGAAAAATG
GTGCTATTGCTCAGACCGCTGCTGCTAATCGCTTCTGTGCTACTTTGAAGTGTGGCAACTGGAATGTCATCGATAGCATGTCTCTTGAACTCAATGGTAA
GACCATTGTCTCGATGGCTGATTACAAGCTGTTTTGGAACAATATCCGCGCTCAGACAAGCTACAGTCCTCGGTACGTTGAAAAGCACGGAGCTGAATCA
TACCTGTATCCGGATGCTGCTCAGTCAGCTTTGTACAGCTCAACTACAAGCTCGACAACTGGAGATGGATACGCAAACACTACTGCCTTCTCATCTTCGT
TCGCTACAACTGGTCCCTCTGGAGGGGCCTCCATCGCTAACGATGGTCTTGTAAAGCGTCTGTTGTCGAACCCTCTTAACGCTGGATCGGATTTCTCCAT
GTCGTGGCCTTCACTTGGTGCTGCTGCTGCTTCTACCACAATCTCAAATCAACTGGCGCGTGGTGCATTCGTAGCTGGCGTTGGAACGGCTAATGGAATT
ATGGGGACGTGGAACTACATGCTAAAGGTAAAGCTAACTGATCTTCACCCTATCTTTAAGGAGTTAGATCTCATGGCGAACCCTCAAATCCGCCTCCGCT
TCCGAGTCAATCAGGGTACCTCTACTATTACCGTGGATGCTTCGAAGGGTATGTCTCTAACCAGTACTACTCTTGCCTCTGGTAATACCTGTCCAATCAC
GGTTTCTGCTTCTTCTACTGGGAATCCGATGGCTGGAGTCCTTGCTGCTTCTGCCGGGTTCAGTATTGCTTGGGGTGCTGTTGTCAATGCGCTAGAGCCT
ACTGTTGATGGTACTTATATGCCTTTTACCACTTTGCGTCTTTACGTTCCGTTTGTGTATCTTGAGAACCCTCAAGCAATCATCTCAAAGCCAGTCAAGA
AACTTCGGTTTAATGATTGCTATGCTCAGTGGTTCTACCAGCGCGCTGGCACTGGTAAGCAATCGACTCAGCTAATGCTGCATTCGATTCCAACTATCGG
CTTCTATTAAGAATGCGAAATATGTAATCTTGATGCCTTTTGCCGAACAAACTGGTAGTTTGGCCTCAGCAGCAGTTCAGGAGTTCCAAAGTCCTTTCGA
TTCAGCTCGTTGGACATTCCAGTATTAGAAACTTTAACGTTCGTACCGGTTCCCAGTAGACCTTCGATATCAGCCATGACTACGATTTCCACCACTTCAC
TAATGAGGTAGCTGAAATTGCATCGATCAATGGTGATCTCACCCCTGAGCTGGTTAACACCTTGTCTCCTAACGTCGTAAGATACGACATGTCCTTTTTT
CTATGTCGTAAGTTACGACATTGAGCGAGTTACAGTTGATTAAAGTATGAGCACGATTTCCCCATACTTTAATCAAGTGTTTTTCAGACAACCGTTGCAT
ATAAGCTGCGAGAGGTCTCTGCGACAAGTTCACAAAACCGGGTCAGAGGATGGGTTCGGATGCGTGATGGATGGCACTCTGGTCCAGACCGCTCATTCAA
GAATATGCGGACTGGCGTGCATGCGGTCTAGTCGTCGAGAGAAACCCGCCGCCCCCGCCGCGGCACCACACGACGTTGACTTCGGACACCTATGGCGGCA
GCTCAGGGCGGCGGGGTGGACGTGTAAGCGGCCGACCGGCATTCAGACGGAGTGGACATATAAAAGCCCGGAGGGCGAGAACGTGCTGGTGGGTGAGCGT
GCCGTGGTGGAGTACGCCTTCGAGTCGGGATTGCTGGTGGAGGACGAAGAGCATGTTGGAGAGGAGGGCGGCAACGGTGAGCATGTTGGAGACGAGGTCG
GTGGCGGAGAGCGTGTTGGGAAGGAGGGCAGTGGTGGTGGCGGAGAACATGTTGGAGAGGAGGGCGGCGGCGGTGAGCACGGCGAGGAGCATGTTGGAGG
GGAGGGCGGAGACGGAGAGCACAGCGAGGAGCAGCGAGATGCAGCAGCCAGCTTGCGCCTGCTGTCGGATGCGTCGGGACTGGAGAGTGAGGGGGAGGAC
GAACGTGCTGTTACTTCACCTATTGCTCCTACACGGCGAACACGGATCCCGCTGAAACTCGACGCCGACGTGAACGTGTTGCAGACCGGGGAGAGCAGCA
GTGAGTATGAGGATTTCAGCTCTGATGAGAGCGATAGTGCTGGCATATGCGACGACGACGGCGACTGTGGAAGCGACGAGTTTGATGAGGAGGGGGGCGA
CGAAATCTCTGATAGCGACGCCGCCGAGATGGACGAGGCTTTTCTGGCATCGCTGCATATTGGTGGCAACGTTGAACTGAGCAAAGCAGCTCTCAAACAG
CGCGCAGAAGCACTTCGGGCAATGCAGTGGACCCCAGCCATGACAGAGTTGGAGACCGGTACTCCTGCGTACCCTGGGTTGGGTGCGGACGAGGCCCGAC
CTGTTGGAGATCTGCTGGATGTGTGGCGATCGCCACTCTTGACACTATTTTTCTTCGTACCGAAAACCGTGTGGGTTTCGATTGCAAAGGAGACTAACCG
CTACTTTTTGCAGCAAGTTGCGAAGCGGGCAGAAAGGATGGCGGCGCTACAGACCGGACGTCAACGTGAGACCGCCGCGCAGATTGAACGGCGCTTGAGA
GCACCCGAGGAGTACGGTGCCCACGAGATTTTGCGTGTGGTTGGGCTTCTAGTGGCACGCATGCTGTGTCCTCAGAAGAGGAGCTTTGCTGCGCATTGGT
CCATGGTCGAGGACGGCGCCATTCCAGCCGGACTCTTCGGGCGGTACATGTCGCGCGATCGCTGCCAAAACATCCTGCGTGACCTTCACTTTGTCGACAA
CACCGCCGACCACGGCCGCGATAAACTGTGGAAGCTGCGTCCTGTAGTGGACAAGACCCAAGAACGTTTCTTGGCTGGTTGGTCGCTTCCAGCCATCTTT
TCTTTTGATGAAGGCGTTCTTCCTGCCACGTCGAAGCGCAACACGACGCGCATGTTCATGTCGGACAAGCCGCACCGATACGGTTCCAAACTATTTATGC
TGTGTGGCGCAAAGACAGCGTACTGCCACAGGTTTTTTTTTTATCTTTTTTTATGTCGTAACATACGACGTGCAATAAGTGCTAACACATCTTTATGTCG
TAACTGATCTAGATTCGAAGTTTATGTGGGCAAGCGGAACAACGATGGAGGAGATACTGGAATTGACGCCAAGACTGGAGCAGTGGCTGTCTTGCGGAAC
CTGAAGACTGCGTTCATTCCTCAATCGCGCCACAACTGGCATGCTGTGATCATCGACCGATACTACACCTCGGTTCTTCTCGCCGTCGAGCTGCTCAAGA
TGAAGGTGTACGTCGTCGGAACGATCATGACAAACCGCTTGGGGTTCGACAAGAGCATCAAGTCCGAGCACAAGACCCGCCCTGCAAGCATCCCAAGGGG
TTCGTTCGTCTTCACGCGCTCTGTTTCAATCCCCGCCATGATCTCGTGCCTCTGGTGGGACCGCAAGCCGGTCTACTATCTCTGCACGGGCTCCGCCATG
ACGCCGGCCACGCTCGAGAGGAAGGTCAAGCGGGTGGGTTCGATTCAAGTTGGATGTCCCCAGTCGGTGAAGGACTACCAGAACTGGATGGGCGGAGTAG
ATCGCCACGATCAACTCCGTCTCCAGAGCTTCTCTCTGCAAATGTCCACGCGGTTTTCCAAGTACTACAACGGCTTGTTCTTGGGGTTCCTCGATCTGGC
GCTGGTGAACGCGTTGCTGACCCACATGGAGGCGGCCAAGATCAAGGGCACCGTCTCGATGAAGCGCTCGGAGTGGTCCACAGTCCTGCAGAACCAGCTC
CTGCAACTGAAGGCCAAGGACTTTGCAGGGGTCGAAGTGACGCCACCTCCCTCCCGCCAGAAGCGTAGGCGAACACCAGTCCGCCTTGCGCACGCACTCG
AGCAGTCGGAAGACTGGGTCACCGTCACCGGCGTTCAGAAGCGGCGCCAACGGCCCTGCAAGGTTTGCGCGCTCCTTCGCACCGAGAAGAAGAAGTCCTT
CGCGACGACGTTCTTCTGCGAGCGCTGCTCGATCGACAACGCCAAGTGTTGGCTCTGCCACAAGATCCGCCGCGACTACAAGGGCATCGCCAAGACCTGC
TTCGAGATCTGGCACGACGACTTCGGCGCCGGGCAGGACATTCCGGCCGGCCTGGGGAAGCGCGTCGTGCTGCGCCGGCCCGGCAAGAACGCAGGAAAAC
GCAAGAAGACACGGCGGGAACTGCAGCTCGTTCGCGATGAAGGAAGCGATGGCGGCGACTCTGACTCTGACAGCAATGGTGAGTGAGCGTGTAGGCTGCG
TTTCAGTTGATGAGTGGTGAGCTTCGTGTGGTTGAATGCAAAGTTTGTTGAGCCAACGTACCTTCTTTCATGCGTTTTCTGAAATGAGCTGCAGATCAGT
GCACCTCCTCAGCCATATGTTGCCTGCAAGTGGAGTAAGTTACGACATTGCGCAGCGATTTCTCGCTCACAATGCCGTATGACTGACGACATTGACCGGA
AAACCTGCTGACAACTTATACACCTATCCCGACGTGAAACACATGGTCTATACAAATACCAAGTCTTTCTGTACGTCGTAACTTACGACATGCGCTTACG
CGTCAGAGGCGAGTACCGTTCGGAGACAAGGTGTTAATGGTCTTCTTGACTACCAGACGTGGTCTCTAACTAACCGTGTTCTCATTGCTGACGTTAGTCG
TCTAACTGAGCGTGATGTCCCCCAAGCGATTCAGATCCAAGGTGTGAATGCTGGATGTCAGGGCACCAATATGTTAGTATTGGTTGTGTCCGAACAAGAA
CTAACCTTCGATAGATTAACTGGGGAGGTATTAGACTATACCACAGCTTAAGAAAAAAACTAATATCTTAGTTCAATTCTGCTAACAGCTTAGGGCATTT
GTCAATTACAAATTGACTCTTACGAAGCCAATCAATGTAATTGGGATCAATTCGACTGATCTGCTTGAGAAACTTACTGCGATATTTTCCCCACGTCATC
ATATATGAATTATTATCAGTTAGAAATTTGGAGTGTGAGAATATTTTGATCTCCTCCTCAATATTGGGTTGATTGAATGCCCATCGACAATAACCAGGAT
CAGAAGAATATACTTCTTCGATCTGGGTGTCCTTGTATTTTCCAAAAGTTAATTCGTTCGACATGTTATCAGCTGGGTGTATCTCTATACATAGCCCTTT
ATTTTTTTTTAAAAGTTAATTAATTAGGGGGGTGCATGGTACTGTTGCTGAAGGAGCTTTAACTGATCTTAGACATAGTTCATATGAGTTAAATGACTCC
TTACGCTGTGAGGTTATCGATTGGTTGTCTGGTTAGAAACACCAGCTGGGTATTAGAATCGATTAAACCTATTCTTCTTGTAAAAATAAGCTAAGAAAAA
AAACTGCCGGCGCAATGTGCTAAGTATTACTACTACAGAGGAGCTGCTGGCGGTGGCTTATCAGTCTGATGTCGTGCTGATTGATTTGCCTGTCGCCGTG
TGTGCTTGCCTTGGCCTGCCTGTCCCGAAGAAGGCCCAGTATATCGACATGGTGGTGACGGTCGTAGAAGGCATCGTGAAGCAAGCCATCACAAATGGTG
ATGAAATCCTGTCGACGGGGGGGAATGTGCTGAACATGCTCACAGGTAGTGGTGCACTGAACGATTCGTCTACGACGACGGACGAACTTCAGGACCTCAT
CGATAAGAATTCAACGTGTGGCTGGGAGCTCAAGCGTCTCGCAGATCGCGTCGTCTACGCTGTCAACGACGTTCGCAATGACACACCCAACGCTGCCGTC
AATGACATTCGAGTGACGGTGTACAAGTCCCCCACTGTGCTAAATGACATTCCTGCGGTTACCAACAACTGTATGGCCGAGTTGCTAACCACGAAGACCA
TCTCGGCAGCCTACGAGACGCGTGATCTACTCCGGAGAACGTTCAGTGTGATTATTGACCAGCTGATTGAGAAGGCTACGACAGATATGGGGGCATCCGT
CGCGGAAGACGAGTATTTGCTCGAAGTCTCGAACATGGGCCTCGTCGTGCTCTCAACGGTCGACCCCACAGGGATCGCGTACTTGGCGTCTCAATTCGTG
CAGCCCATTTGTGGACCCACCGCCTACCTTGGCGAGATCGACGATGGCACTCTATACGATGCGCTGGGTCTCATGACTGTGGATGAGGCGTTCGAAGGTA
GTTACGGATCGTGGACCAAGGCGGGTGACGGAGTCGTTCGTCTTATCTTTGAAAGCACGGATAAGGAGGATGTGACGGTGGTCATTCATACGGGTGGAGA
AGACTATGCCGAAGTGGACGTCGGCGCAGGTGAGACGGTGGTTTGGGACTCCACCGTCCCTGAGCTACAAGACAAGAACATGTACCTCGATCGGTGGCGG
CCTGGCTTGCTCGGCTTGCCAGGCTCAGGTGGCGGGTCATTGCTGCTGTGGATCCCGCGTGCGGCGGACGGTGGCCACATCACTATGCACGTACGGATCA
ATGTCAGCTAGAAGCATGTCGACAATTACCCCGACATTATGCAGTGTTTTAACCACAAAAATAAATGTGCAAGTGCAAAATATCGTAGCTAACCAAAAAT
TGGTTTCAAGATTTGGCTGTCGTCTGATTTTCGGCCAATCAGCGTTCCTCCAACATTCAAATTATCGCGCGTTCCAGTCCCCAAAAAGCGGCCGCAGCAG
CAGCATTCGACATGAGCGAGGGACGTCTGCAGCACCTGCTGCAGCCCATTCGGTGCGTGCTCTTCTCTCTCATCCTCTTCTGCATCGTCTCCTCCCTCTT
CTGACCTATTTCCTGCTCTCTAATTTCCTCAGGGACCTGAGCAAGAACTGGAACATCGACTTGGCCTCCGAGTTGGAGGAATACATGGACAAACTCGAGA
ACTTGAGCATCGCGTTCGACCCAGAGGACGGCGCCAGCATCGACAGAGACGGGGACAGCGTCATGAACTTCGCCGAGGCCGCGCTGCTCATCCAGGGCAC
GAGCGTCATCTACAGCCGCAAAGTCGAGTACCTGCACGCGCTCGTGTTCCAGACGCTCGCGCATTTGTCCAAGCAGCAGGACGACAAGCCGCAGAATCAG
CAGAACGGGGAGCCAATAGACGGACAGGACGAGGAGGAGAATGATGACGCAGAGGCCGGCGCGTTCAACAACCCACTGCCGCTCTACGACGAGCTACAGG
AGGCCAAAGCTGCGCACATTACGCTGAAACAGGTGACGCAGCAGGACGAGGAGACGGAGACTGATAGGAGGAGGAAGAGGAAGGAGGCGCGCGCACTTAA
CAGGAGCAAAAACAACATGCAGGCGTCCATTGCGCTCATGGGCTCGCTCGTGCCAGATGAACGGGACCACGGAGAGACGTTCAAGCTGATGTCGTGCAAT
TTGCACGCCACGGGCGTGCTGCTGCTGGACGAGGCGAGCAAGAAGTACTTGCGGCCGCAGCAGCAAGCGATTGGAGACCAGTCGCTTGCGTTTGGCGAGA
CGCCGGGCAAACAAAAGGGCATGTGGGTGGCGGCGGATGGCGAGACCCCCGCAATGGCGCTGAACTTTGATGATATGGACGCTAGCGAGGATGATGGCGG
AGATGGGAATGGATTGGACGAGCAGCCGGACTACGAGTACGACGGTGGGGATGCGATGGACCAGGACGTCCCCGTGGAAAACACTGGAGATACTGCGCAA
GAGGAAGGCGCGTCCGCCCCAGAGCCGCTGGGTCGTGTAACTCGCTCGGCTACAGCACCTCCGACGGATGAAAAGGACCCGTGGGCACCTCTGGATGCTT
ACGATGCCAGCACCTCGGTGGCACGGCCATTCCGGAAGGGCCGATCATACCCGAAAGTGCCGGCGTACAAGAAAAAGAAGGCAGGTGTTGCAGCTCTCAG
CAACAAGGAGAGCGCTGTGGGCATGGACGACGATGCCGAGCAGGACGGCTTGTCCGACCCGACGTTCCAGGAGCGCTTCTTTATGGGATCGGACGGACCG
CAGTGGGCATCGTGGGTCTGGACTGAGACTTTGAGCGACAACCCACTGGAGAAGACGTGCAAACGAACCTTCTGCAAGGCACCACTTCTCGTCAAGAGTT
GCGACGCGCTCTGGCAGCGTGAGGCCAAGTGGCGCAGTGCCATGCGTCGCTGCGAAGCTCGGGAGAAGCAGAGTGCTCAGGCTATGTTGCTGCGCGAGCA
GGCTATGGAGGAAGAGGAAGCCGAAGGAAACGACCAGATGCAAGCGTTGACGCTGTCCACGGCGACAGCACGACTGGATATGGCTTTCCGACATGATGCT
AACGGAACTAACGATGACGAGGACGACGACAACGGAGACGACAATGCTTACGACGATGGGTTTGATGGCGGCGACTGGGACCAAGGGAACGACATGGACG
ACCCGATGGGCTCGTACGAGGCAGCCGCTGCTGCCACGGGCAGTTCCGGTGGACCGCTTACGTACGAAGAGATCTGCAGGCAACACTTGGCCTCCTTCAT
GTCCGGTACTGAGAAGTACGTGCGCGAGACAGACCTGAGCAAACAGGTCAGCGACTGGCAGGAGAAGCTGACGCCTCTGCTCAAGCAGCAGGATGCGCAC
CCGGCCTTTGATATCCATCACTATGGCCGTGAGATCATCGACCGTCTGGAGGAGGAGCAAAAGAGCACCAGCCTGGACAAGCACAGCAGAGCGACGAGGA
AAGATAAAGCGACGAACAAACGGGCGAGGCTGGACCCAGTACCCGAAGACGAGGAGGAGATCGAGACGGTGCCATTCGAGACACTGGTGGGCGGGAAGAG
TCCATTCGAGGTCTGTCGGCTCTTTCTGGCGTCGCTGCAGCTGGCTAACAACGGCAATGTGGCGCTTTCACATGCACACACCACAGCTGATCACGGCAAG
GTACCGTTCAAGATGCAACTGCTCAGCACAGCCAATGCCTACGAAGCCTTGCAAGCTTGA