Transcript Name :
Phyra_g10169
Orientation:
(-)
Number of Exons:
8
Description :
OWZ18887.1 Phosphatidate cytidylyltransferase [Phytophthora megakarya
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-37
38-60
61-129
130-152
153-163
164-186
187-190
191-213
214-232
233-255
256-296
297-319
320-396
*** None ***
PositionContextScore
7MALRKRR|SS0.674
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1873 bases(100 bases per row)
TGGCCTTGCGTAAACGCCGCTCGAGTCCCGAGGGGAGCCCCAAGCACGCGCAGAATGCGTTGCCACCCGCGGTCAAGCCCGCAGGAAGACTGACCAAGTT
CATGACGCGCGTCGTTGTGGGCTTCGCCATGATCGGCGGCTTCATCGCCATCCTGTACGGCGGCCACATGTACGCGTGGGGGCTCGTGGTACTGCTGCAG
ACGCTGCTCTTCCGCGAGCTCGTGAACGTGCGCTACCGGGCGGCGGCCGAAAAGAATATCCCGTGGTTCCGCTCCGTGCAGGTGCGTGCAGCTGCAAATG
GAGAGGGGGAGGAGGAGGGAAGGTATAGACTAATGCTGACTCTTGTGGCTGCAGTGGATGTGGTTCGTGGTGGCGCTGTTCTACAACTACGGCGACTCGT
TCGGCGCCTTCATCGAGAGCAGCAAGATTCGCTTCGTGCCGCCTGCCATCGTGCACTACCTGCGGTACCACACGTGGGTGTCGTTCACCATGTACGCTAT
GCTCTTCGTCATGTCGGTGCTGAGTCTCAAGAAAGGTGCGTGACTGTAGATTTGATGTTGAGCTCGTTGTGCTGTCGTACGGTTGCTTCAACGACTGACG
CTGTGCCGACGAACATTTTGGTGTCAACGATGTGGTTTTATTGACTGGGTAGGTTACTACAAGTACCAGATGGGTAAGTTGGCAGGAATCTCGTTTTGAG
TTTGCAGACATTCTAACTTGTGAATTTCTCGCTTGCAGGGCAATACACGTGGACCATTGTCACGCTGGGTTTGATCGTCTTCCAGATGAAATACGTCCTC
ACGAATATCTTCAACGGTACGAATGTGATAAATATCCCGACCTTGTCACAAGTTGCTAACGGGATTCATATGCTTGTTCACCCCTCTAGGTCTCTTCTGG
TTCTTGTTCCCCGTGTCGCTCGTGATCTGCAACGACTGCTTTGCGTTCTTCTGCGGCAAGCTTTTTGGTCGCAAGTTCATTAAGACGCCGTTCCTGCGAT
TGTCCCCGAACAAGACGTGGGAGGGCTTCATAGGTGCTTTCGTTTGCACCGTGATTTATGCCTTTTTTTCCAGTGCCTTCATCTCGCAGGTACGAAGCAA
ACACGGTACCGTTTCGCGTATTTTGTTTATTGATTGTGTTGTCTTTTGTTCGTTTTAGTTTTCTTGGTTGACCTGCCCCGTGGAGAGCTTCGAGGTGAGA
GCACAGTGTTTAGTGCTGCAAAGCACTGGTCTTCATGCAGCATACGTGCTTATGGTAACACTGATGTCTTTATTTTGCTACAGTTCAAGCTGATTCCCGA
CCCACTCACGTGCACACCTCGTGACGTGTTCCTCCCTCATTCCTACGGCGTACCGGTCTACCTGGCGGGTCTAATTGGTCGAAGCCAGATCCAGCTTCTC
CCGATTCAGGTTTGATGTTGTGGCTGGCTAGATCGATGTATGGCGATTGCTGACGAGCTGTCTGGTTGTGTTCGTGAATGCAGTTTCACTCCATCTGGTT
CGCGATCTTCGCCTCCGTGGTGTCACCCTTCGGAGGTTTCTACGCTTCGGCAATCAAGCGTACGTACAACCTGAAGGACTTCGACTCGGTCATTCCTGGC
CACGGTGGTGTCATGGACCGAATGGACTGTCAGCTGATCACAAACTGCTTCACGACGGTCTACTTCAACACCTTCATTCGGTATGTCGTTTCTCTAGTGT
TCACACGGCCCGCTACATCGTGTTGCTAACAGTTGTTGTGCTTTGTGTGTTGCTCCCTCTATTGCAGTTCGTCGACACCGTCCGTGGCGCTGATTCTGAA
CCTCGTGGCGCAGTTGACACTCGACCAGAAACAGGAGGTGCTGCGAGCCATCCAAGAGATGCTCCAAGGCTGA