Transcript Name :
Phyra_g14294
Orientation:
(-)
Number of Exons:
3
Description :
KUF89708.1 hypothetical protein AM588_10003848 [Phytophthora nicotianae
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-676
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3593 bases(100 bases per row)
TGAGGCTGCACTACGTCCTGCTGTTAGCTAGTGCGGCGCTATTGTCGACTATCGATGCTTCCTTGGCGATCGCGTCGTCGAAAACGTCTACGCTCAGCTC
CCCGGCTGCAGCTCGCTCACTCTTTGTTGAACAACACAACATCGTTTCCAAGAGACTCTTGAGAGCTGAGACCACGGCGGACGAGGACGAGGAAGAAGAA
GAAGAAGGAGAAAATGAAGAAGGAGAAAATGAAGAAGAAGACGAAGAGAGGGGGATTACACTGCCCTCCAGCGCTACCAAGAAGATCGCAAAGCTGGCTA
TGTCGAGTGACGAAATTGCCCGAATTCAGGCCAAACTGGACCGCGTCTTCAAAGGAATTCAGCTTGATAAGAAGAACTCGTATCTCTTCGGTGATGCTAA
TCTGAGAAAATGGGCTCAGAATGCACTCAACATGCACGGGAATTCCGAGACGGCTTCGGCGGCTATGTTATCTACGTTAACCAAATTCTACAAGCCAGCC
GATCTGGCGAGGTGGATCGAATCAGCTAAGGTCGCTCCGAGTGTGGGAAACCTCGCTACGAAGCTGCAGGAGGCGCAGTTTACAAAGTGGCTCGCCGGAG
GAAAAGATGCACTTGGCATTCGGGCAATGCTGAAGAAAGCTTCTACTGGACAGGCACAGAATCCGTTGCTTGCGCGGCGAGATGAGCAAATTGTCAAAGC
GTTCCATACGTTCGTTAAGCAGCAAAAAGGTATAATAGTTTGAGCAGATAGAGGCAAGCTCTCGCTTCACGGCCCTTGATAATCGTACTCAATTGGTTTG
CATCATCGTGCGCTTGTTCCACATGCTGGTCCTTACTGTACAACGTTCACCACCAGCGTTGTTTGCTGGTAAAATAAGACCGAAATAATACTCTCTCTCT
CTTTACCCGGTGGGTCATGATGACCTCCAATCTTTGTCCTGGTTGTCCCCCTTACCGAGTACATGTACTAGTAAGTTACAATACTGTACCTCATTTCCGA
GTGGCGGGTGGTTCTGTGGTGAATCGTGTCTGCGCCGCATCCTGCCGTGGGTTTCCTGGCTGCAGCAAGCTCGAAAATGGGCCAGCGATTTCTGATCTAC
TAAGTGCGAACTTACCTTCACTTGTGTTGTTTTTGCATGCAACCGTCGACGTAACGACACAGCACTGATTGGACCGCTCGCATTGTCACTTTGGCATTCC
GGTACAGCTTCACGCCTCGATCGATTGGACTCTACTATGGCGATCGAGCCTCGGAGCCCTACCTATGCGAAATATGGATGAATATCGTCAAATCTCCGAT
CGCACTTAACTTCACTATGTATATTAACGACCAATAGAAAGAACGGATTGGCAATTGTTTAACTTATAACGAATCAAGTCAGTCTGTGCGATCTATTTTA
ACCAATTGTGGGGCCAAATTCGTAAAGGCCCCACAACCACACCTCCGACGTATCGTGTCGGAGAAAGCAGAGAGTTATTGATATCCCTCTACAGATTGCA
AGTCATTCGTATATTCTTAGAATAACACACAAGCTCCGACATCTCCGACCCAACATGAGCCTCAACGACCTCGCACCGGCCAACACCAAGCGGGCTCGGG
AATGCGCAGCACGCTCGTTCCTGAAGTTTCTCGAGGAGGAATCCGTCAGCTGGGAGTACTTGAGAGTGTGCATGCAGCACGATAGTGCTTCGCTCGTCTT
GGAGACTGTGGTAGACAAGTTCGGCATGTACCTCGCCTTCAAGGAAGGGCGCAAGGGCCAGCTCTTAGCCCGACACTCGGTCATGCAGTACTACCGACAG
GCCAAGACCTGGCTGCTGGAACAGTTCCCTCAGCATCGAGCGGGGATCGACAAGATTCTGCTGAAGAAGGGACAAGTACTGGAACGGTACTGTATGAAGA
GAGAGTCGGGGGCGTTTGTAAACAAGGCTCCTGCATGCACGAAGATCGCGCTTAAGCAGATGATGGTATATCTCTATTCGACGGCTTATACCTCCGCAGA
CTACCAGGACGCCGCCTTGCTGTGTCTGCTCTGGTTCCTTTTTGGGCGTGCGTCGGATCTTACGATGCTTCGCAAGGCCAACCTACCCATTGGCGCAGGC
GACATCTTCTTCGTGCGCTTCATCCGGGTCAAGACTGCAGAAGAACAAGGCCTCTCGCTCTTTCCCGACGACGACTTCTCCACATGCCCGCTTCTCGCCA
TCGCGCTTGCACTGGTGACGCAGTCTTCTCCGACGGCTTCGCTTCTGAGTCAACTTTCGGAGCCGCAGACAGTCTCCCGAGCGACGCTGACACCCGCTAC
GTCTCTGATTGACTTGATCGATCACCCGGAAGCTGTGATCCCGCTGCATCAAACGGCCAAGAAGTCAGATGAGAGCAAGACGGCCGATACAGCACCTGGG
ATCCACAGCTACATCAATCGCGTTCTGGACAGAGTCGCCAAAAATGCTGGCGTGGCCGAGCGTCTGACGTCGCATTCCTTTCGGCGGGGCGGAGCTCAGC
ATGCAAATGGAGCTGGAATGTGCGTACAGTGGATTTTCGACCGTGGAGCGTGGAACATGACGGCGACGAACAAAGCCTTCTCGTACGTCTTCAACATTCC
TGCCGAGGACCACAGGGTTGCACGAGTCTTGAGCGGCCGTGACCCCGAACAAAGAGTTCGCCTTCTGACGCTGGACTGCTTCGATTCCGATACCCAGTCC
AAGATCCAGTCCGTAGCGGCAGCACTCTTCAACGCTTCGTCCGGGCTGGAGTCGCCACCGTACAACGTGAACGTGCGCGTCATCGACACCTTCATGGTGT
ATCTGCTGCGGCACTATCCGTCCTTGAAAAGTCTCAGCACTGACGGACTGGAGATTCAACGCATCGAGGCTTGCGCAGTTGAGAAAGGCTTCTCAGTCAA
CGATCTGCTGGCGTGGTCGTCGTTCCTGTCCTCGAACGCAACGACAACATCTGAAGCAAAACATACAACCACCCAAGACACCACGGTAGCTATCACAAAG
CACTCCATGTTTCTTGAACAAGCAGCCTTGATTGAACAATTAATTCAAGTGAACCAAAAGCTGGATACTCGTCTGTCTATCGTGGAGGCTAAGATACACA
ACAAACAACAACAAGCTCCGTCAGCAATGATTTCAAATGAAGATATAAGCAACAACGATCCTCAAACCAAGCGTCGGCGTACCTCTGCTGCTACCAACCT
GAAAGATGCTTGGTTTTCTTGGTACGCTCAAGAACCGCGGATGTGGAGCTCAACGGATGCAGCGACCAAGCACATGCGGTCGAACGCCAAGTTGATCGTC
GCATTCTTGAAGCTGTTTCTTCGAGATGGCTTCGAGCTCGATAAGAAATCACCGCGGTATCGAGACGAGATCCTGAAAGTTGGTGCCAGCGCGGAGACAC
AGTTGCTGTTGTATCTCCGCGAGCACAAGACCACAGCTCGTGGGGCCCAAAACGTCTTGAAGTCGATGCGCAAGCTGCACAAGTCTGGTCACCTCAACGA
ACACGTCCGCCATTACAAGCAACTTCAAGCCGGCGGCCGCGTAGTTGACCCTGCTCCTTCGCACACCACCAACATACTAGGTTTAGTTTAAGC