Transcript Name :
Phyra_g5778
Orientation:
(+)
Number of Exons:
1
Description :
XP_008904654.1 hypothetical protein PPTG_10904 [Phytophthora parasitica INRA-310
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Cyclin-like0.0000002SM00385
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Cyclin-likeIPR013763
*** None ***
InsideOutsideTMhelix
1-348
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1046 bases(100 bases per row)
ATGCCCTTCGCGCTCCCCATGGAGTGCGCCTCCGAGTCGCTCGAGGTCATCCAATGGGCGCTGCTCAAGGAGAAGCACTACCCGGCGCTGCGCAACCCGC
GCTACCTCGCGGACGTGCAGCGTCACGGCATGACGGCCACCTGGCGCCTGCGCGTGTGTCGCTGGATGTTCGAGACCGCCAAGGAATTCGAGCTGCAGCT
GGACACGGTCTGCGGCGCGCTGCACTTCCTGGACCAGTACCTGAGCGTGCACTCGGTGGACCGCGTGACGCTGCAGCTGCTGGGCATGATCTGCATGTGG
ACGGCCAGCAAGATGCACGAGGGTAAGCCCATCCTGCTCGAGGAGATGGCGCTCATGTGCGAGCGCAAGTTCTCGCGCGCGCAAATGATCGACGCCGAGG
CGCAGCTCGTGCGGCTCGTGGGCTTCCGCTTCAACCCCCCGAACGTCCTGACCATGGCGAGGGACTTCGTGAACGAGCTCCCGTTCGACGACGACCAGCG
CGCCAACTGCGTCGCGTCCGTCTTCAACGTGCTCGAGCGCGTGCTCGAAGACGTCTCGTCCCTCGACTGTTCCGCCTCCAGTCTGGCCAAGGCCGCGGTG
CAGCTCGTGGCCAAGTCCGAGTACAACCTCACAGTGGCACAAGTGCTCAAGGCTCTCAAGTCCATCAGTGTCGAGGAGGGTGCCTACCGCGCAGCCTTCA
AAATTGTGCGCGGCGCCTACTTCGGTACGTCCCCCGCCTCGACCAAGACCCAGATATCACAAGCTGTCGCTGTGGAGGCCATCAAGTCGCTCACGCAGAG
CCCCACGGCCATCGAACAAGTCGCTGTTTTCGCCGACGACACGCCGTCGCCCCCCGACGTGGATGACTCGTGCCTCATCTGTACCGAGACGCTGTCTCCG
TCCCCATCCCAGGCATCTCCTGCGCCCGTGCGAACGGCTGCATCGGCCTCATCAACCATCGGAGTCACTCGGTCTGCGCCCTCACCAACGTGCATCGAGT
CCGATACCGAGCGACACAACAAACGTCAGCGCAAGCTGGACATGTA