Transcript Name :
Phyra_g2224
Orientation:
(+)
Number of Exons:
15
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-902
903-920
921-966
967-986
987-989
990-1012
1013-1031
1032-1054
1055-1073
1074-1096
1097-1411
*** None ***
PositionContextScore
351QRSRIGR|GA0.506
1183AKYRHFR|SL0.523
1208RRQRERR|AQ0.566
1254TRQRERR|QT0.68
1278RVRRRRR|QL0.663
TypeScore
mitochondrial43.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        7488 bases(100 bases per row)
ATGTGGAAGACCGGAGTACGGGTTGTGACGCCTCTGCGGCGCTCGCTCACGTCTCCGCTGCGCGGGCAACTACCGAGTGGGCGTCCGCGGTCACTGCAGG
TGCTGTACGTGGCGCGCCCCTTCTCCACGTCCTCGCCGCCCCCAAGTACGTGACTTTTATTGCGTAGATTGAAGTGCCCAATCTAATGCGGAATTGGGTC
TTTTCACTCGCTCTGGGTTTTATAGCCACGCAGAATGTGCAAATGGCGACGGCGGCACTGGTTGCAGCCGGTGTGGGCTATCTGTGGGTGACGAATGACC
GCCAAAGCGAGCAGCAGCGCGAGCTGGAGATCCAGAAGGAGCGCAAGCTCAGCAACCGTCTGGCGGCCGAGCTCGTGGCGGCCGAGGCCAGCCAGAACAA
ACTGGACTGGAAGGGTACGCTGGAGCGTGTCGTACCAGCTATCGTGTCGCTCAAGCTCAATTCACCTAAGGTGAATGATTTTTTTTTATTGTGCTGACAT
CATCAATGTTGACTGGGTGATTGCGTCTGGGTTGTTTTAGTTCTTCGACACGGAGTCGCCGGGCAACGGGTCGGCCACAGGCTTCGTCGTGGATGCCGAG
AAAGGGATTATTCTGACAAATCGTCACGTCGTGGGACCGGGGCCCATTGTACGCGAAGATGTTTTTGGGTAAAAGGGGAATAATTGTTGATGAGATGTTT
TTGTGGGTTTTATTAGGACGCCGAAGCGGTTTTCCAGAACAACGAGGAAGTGCGCGTGATCCCCATCTACCGTGATCCCGTGCATGACTTTGGCTTCTTC
CAGTTCGATCCGGCGGTAATTTTGCTTTCGGTTGAAAGGGTGATGTTGGAGATATTTAAGTATTTTTTCTTATGGCGATCAACAGGATGTGAAGCACATG
TCGGTGCCGTCGCTGCATCTGCATCCGGACAAGGCCACTGTTGGAACGGATATTCGTGTGGTGGGAAACGACGCAGCCGAAAAGCTTGCCATTGCTAGTG
GCACGCTGGCGCGTCTTGATCGTGACGCTCCCAACTACGGCTTCAACAACTACAACGACTTCAACACGTTTTACTACCAAGCTTCGTCAGGTACGGTTTC
AAGGAAGGTTTTGTATCGCTCCGCTTGGGCTAGTTGCTTATCATTGCTTCTGGGTGGCAATGCTGCTATTGCAGGAACGACGGGGGGATCGTCGGGCTCT
CCTGTGCTCAACCACGATGGCGATGCTATTGCTCTTAATGCTGGCGGCAAAATTGGCACGTCTGCTTCGTTCTACCTACCTCTTGATCGTGTAAAGAGAG
CGTTTGATTTAGTTCGAGAAGGTAAGGACGTGCCTCGCGGCACAATCCAAACAATTTTCAACTACAAGCCTTTCGACGAGGTGCGCCGACTTGGCGTAGA
CCCCGCCACGGAACGGCTCGTTCGCTCGACTTTTCCGTTGGAGACAGGCATGCTGACAGTGGCAGAAACTATCCCGGGTGGCCCCTCAAACAAGAAGCTG
CAGCCTGGCGATTTTTGGTTCGCGTCAATGGAGAGCTGATTACACGATTTGTGCCGCTGGAGGCTATTCTCGACGACAATGTTGGCGATGAGGTAAATGT
GCCTATTGAGTTCTTGCTACGCTTTTCCCCTGCAACGTAACATTGCTGACACGTGGATGGCAACATGTTTCGTAGATCGAGCTTCAGATTGAGCGATCTG
GAGAACTGGTGACGCACAAGATGCAGGTGCAAGACCTGCACGCTGTCACCCCATCCCGCTTTATCGAAATCGGTGGGCAGTAATCAACCCACTGTCATAC
CAACAAGCTCGGAATCATGCCATGAGCCCTGGAGCTCCGTATGTTGCAGATCCGGGCTACTTCCTGCAGCGCTCACGGATTGGTCGTGGTGCAATTATCC
ACTCGGTGAATGGCGTGAAGACACCTGACCTAGAGACGCTTAAAAACTACCTAAAGCAGTGCAAGGACCGGGAACGCGTCGTAGTGAAATTCTCAAAACT
GACGGACAAATCGGAGAAAGTCGAGGTCGTGCATGTAGACCGCAGGTGGTTCCCATTCTGCGAGTACGTGCGCGACGACAAGCTTGGTACATGGCATTGC
GAGCGCTTTGCGCCACCCAGCAACGCGAATGATGATAAGACGGACAACTCAAGTGCCGATAAGCCAGTCGGCTCGACGACAACGCTGCCGGGCAAGAACC
CAGTTGAGAACAAGCTAGCGCGATCGTTGGTAACAGTTGACTTTGACCGACCGTTCAGCGTGAACAGTTTGTCAACGTCGAACTACCGCGGTACAGGACT
TGTTATCGACGCTGAGAAGGGACTTGTGGTGGTGGATCGCAACACTGTGACAGACTCGATGGGCGATGCTATGGTGACTTTCGCCAGCACCATCATCGTC
CCAGCCCACGTCGTGTTTGTCCATCCGGTACATAACTTCGCCATCGTACAATACGACCCGAAGCTCATTGGGTCGACACCCATTGAAAGCTGTCAAGTGG
CATCTACGCCATTGGTGCCGTCTGATCCAGTGTGGCTCGTTGGTCTTATGAGCAGCGTGGGGCGTAGTGGCCATTCCGACCTTGTTTCCCGCGAGACTAT
TGTGTCTGGCGTTAAGTGGATTGGCTTGCCCATGCCGAACCCACCGCGCTACCAAGAACACAACCTGGAAATGGTTTCGTTGCAGGACGTCGTTGGCACC
GAAGGTGGCGTTGTATGCAGTGATGAGGGTGAAGTGAGTGCCTTTTGGGCTTCTTTCTCGTTCCAACAGCAACGCCGTAGCTCGAAGGTGGAGAGTCAAT
TCAATCGCGGCATTCCGATGGATTTGATCATGGAAAGCGCGGCGCCGCTTATGCGTGGGTGACGCCAAAAATTTACGACCTCGGTGTTGATTTTGAGCAC
TTGAGCCTGGCCAAGGCTCGAGAGCTTGGACTTGGCCAAGCACTAGCCGAGATTTTGGAAAAGGATGCGCCTGATCGCCGAACCATCTTGAGCGTAGCAC
GACGGTGGGGTGGAACCGAGGCACAGGATGTGCTCAAAAACGGCGACATCTTGGTTGCTGTGGATGGCAAAATCGTGACAAGTTTTCGCGAGGTTGAGCG
CTGCACACAGAAACCGGAGGTGCAGCTCACGATCGTGCGCGATGGCCGCGAGATGCAACTGGACGTAAGGACCCTTTTCATGGAGCGCACGGAGATCAAC
CGCATCGTGTTCTGGCAGGGTTTACTCCTACAAGCGCCACCGCTATCCGTGTCAGCGCACGCAGTATCTCGTTGGACGACGGTATCTACGTGTCCTGCCG
ATACTCGGGCTCACCGGCTGCGCGCTACGGCCCGCCGCCCACAAGTCGTATCAAGGAGATCGATGGTATCAAAATCACGAGCATTGACGACTTCTTGCGC
GTCGTCACTGCGAAGTCTGATAACGATTCGGTGCGTATCAAGTACACGGACCTCAGCGGCAAGGATCGTTTAAGTACGCTTAAGCTCGAGCCAAAGTACT
GGCTCACCAGCGAGCTGGTGCACGAGGGAGGTGAATGGCGTCGTGTCCAGCACTGAAATGGCTATATCTGAAGTGCGTGGTGTCCAAACGAAGATGGTTC
CCCTCAAGAATCAACCGACTCAACCAACAGCTAAAACGAAAGATAAACGCAGTGTCTGGCCATAGCAACTTGCTGTGGCCCTGTTTCAAAAATGGTGTTG
GTGTAACGACTAACGGATTGGTTTTAGTGTCGGACTCGACCGATCGACCACGAATGCTGAAGTACAGCAGAAGGAAGGAGGGCACTTGGTGCTCTCACCA
GCTCACGACCAAGGATGTTATATTGTTTGTCTGGATGGGTGTTGGGCTACTGCCTTTCTTCCTGCAGATTCGAGGTTTCTCTCAGTTCGTGGCCCCGCAC
AAAATTTCTCTGCACTTGGTGACGCCAACCCATGCAGAAATGGAGACGAGCGACCTGCATCGACAGTGTCCCGTTCAAGAACTTTACATGGCAGGAGCCT
GGTGGAACATTCGCCCACGCATTACTACCGACTCGACAACGGACTGTTGTGCCACTACGTCATGCCGCAGTACAACGTGCACGGAAACTACTTTCTCGGA
TTCGATAAGGTTTCACCGTACCGAACGACACCCGACGGCTGCGTCAACGATAGCTACCTGTTCGAGAGCTACTTCTACCACGGAAGCATCGGAGGCTATT
CGTTCTACATCGAGGGCGATGGCACATACTGCGCACTGGACGGCACGGCCTACGACGTGGTGAAAGGCGTCGGCACCTTCGATATCAACGGCGCGAGGCT
GGCTGACGACAAGGGGGACCCCAACTACCGCAGGTCATACTGGTACGCACTCACGGGCTCAGCGTGGATCGCGTACCGCTTCTGGATGCTGCGACGCAGC
TTCGTGACGTGCAGGCGGTTTGTGCGGCGATGCGACCCGAACGCAGAGCGCATCAGCTTCCAGGACGCTATGGTGTTCGTGCAGGAAAGTCTGCGGCTAT
CGGCTCACGGGGCGAGGAACTACCACCGCGTCGTGCTGCTGTTCTTGCTGCTGGACCTGGGTCTCATGAGCGACCTGTTCTTGCTGATCACGCAAGAAGG
GTTCATGGGGCGGATCCAATCCATCTCGCTCGGCTACAACCTGGCCAGCATCATGTCCACTCTGTTCGAGATGGTGGAGGCCATGGGATGGATGAGGGAG
ACGGCTCGCTGCTTCGTCAAGCGGTTGCTGTTCAACTACGAGACGGCGCTGGTGGGCGAGTTGCTCACGGCGGCACTCATCCAGTACTACCTGACGTCGC
TGAACCGGTCGAGTCTGCGGCACACCGAGTCGGAGGCTGAGGCCGTGTCGTACTACGTCATGAGCCTGGTGGGTCACGGCTGCATCGCGCTAGGCTGTGT
GTTCGTGATCGTGTGCACTCGCGTGATCGGGACGCTGGGCTTTGTGCGGTGGAAGTACGGCAATTTGTCCTTGTTGACGAAGCCATGCTGCGTGGACACG
ACGTTGGGAGCTCGGTGCAAGTTGATTTTGTTGGCGGGGTACGTGTGGGAACGTGGCGAGTTGTTTTATAAGGTGAGCACGCTGAAGGCGTTTGGTATAT
CGAAATTGACGGAGGAGGATGGGTGCGAGTTTTTGATGTACTCGAAGCTGCACTGGTTCAGTATTCCTCGAGACTGTCTGGTGGTGTTTGGGACTACGTC
TGGAATGCGAGTGCAATCATGTGAGGAGCGCTCTTGTATTTCAGGTATGGGCATTGTGGGCGAATTAGACCGAGTGCTTGGTGGTGCACTTGTGGAGCCC
GCGGATAGAAGGCGATTTTCTGGTAAGTTGCATATTAATCTGGTTCTAACCGAAGGCACAACCTAATTTATCATATTGTGTCGTTCCAGTGTACAAGCAA
ACCGAGGTTAATTCACACGCTGCATCAGGTTTTGCAAGTAACAGGATATGCCCAACTAACGAAGGCTGATACTTTCGAAGTGCTTAGTAGTACTAGACTA
AAACTTTCTGCCGTAGGCATTAGTTCGAACGTTTCTGGATGTAATGGCAAGACAAGCATTTAGTTTCGGATTGGAAAACAACATACTTCAGAGTAGCAAG
GATTTATCATGCTTCTCGCTCTTGCAGTAAGCATTGCCGCTTGCAAATTGAGCGTTGCACTATGCACTATGTGTGTGCCATACAATATTCTCTACAATGC
GTTGGTATGTTGCAATAATCCATGCTGTTAGATCTTCAAAACGCAAGGATCTAACCAAGGCATGCCCATGAAATGCTCTTGCACGGGACACCATCGATGC
AGGCCGGTCGTCTCCATTTCTCCATCGTTGAAGCCACCAAGTGGTATTCGTGAGCTGCGCGAATCCACGAAGCTGCAGAGTGAAAGGCACTAACGCCATT
GCGAACCACAGCACGCTGCTCATTGTGCAGCACGATGGTAACTTTGGTCGGCAAGTTTTCATAACGTCCATCCCCAACCTCCACCCGCGCTACCTTCTCC
ATGACTGCAATTATGGCCGCAACGACGCTGTCCTCCTGCAACGAATTTAGCTGTTCGTTGTGGTTTCGTTGTGGTCGCGCCTGTGGTAAACAAGTAAATG
GTGAACAGCAGGAAGTATACGCCGTTGTTCGATGCTGGACAAACCTGCGAAAGGGACCAAAAGAGAATACCGTTAGGAAGAAGGAATCGATAAGCCTAAC
ATGAGCTCAGTCTTTAATTTGACAAGCGAAGTCTATAGCACGCCAGTTGTGTGTGCACGCAGCTTGTTGAATGAGCGCTTTAAGACTCGAAACGGAAGAC
GCTCAACGATGAACTGATCCCGCCATTGAAATGGCCCTACGAGTCCCGTCGTAGCCAATGCGAATCACAGTATCGACTCATCATTACAGCCCCATGCCAT
GATGACCCATGGGCCACAGCCGGCCAACGACTTACTTACTAATATTAATAGCTCACAACATAATTTACGGTAATTTACGAGCTCCATTTTTCGGCCATGG
AGACACCGCCGAGCATCAAGCAGCAGTATGCGAGTCCGCCGCGCGAGGCGCCGGAGCAGCGGCGTAGGCGATTGGCCAACCGGCGCGCGGCCAAGTACCG
GCACTTCCGGTCGCTGGCCCACGCCGCAGACCCGACGGCTGCACTCCAGAGGCAACAGAACACACGCCGGCAGCGAGAACGGCGGGCACAGCTGGACGAC
GAGGCGCGCGACCGCATGCGCGCGCAGAACCGAAGCCGCCAGCAGCTCCGCCGCCAGAGTTTGAGTGCGCGCGCCAAGCAGGAGGACCGCGAGAAGCAGC
GCACACGGCAGCGCGAGCGGCGCCAAACGCTGAACGCCGAGGCGCGAGAGGAGCTGCGCGCGCGGGAGCGGCTGCGCGTCCGGCGTCGGCGCCGCCAACT
AAAGGCCGCGCTGCCGGTCCCATTGCATGTACAGGAGCGCGAGCGGCTGCCGCATCTGAGGCTGGCGCCGAGCTACCAACGTTGCGCCAGCATCAGGAGC
AGCAGAGACAGAGACTCCCGTTCGGAGGCGGCGTGCAGATCACGCTGCCGCCGCCGCCCATGGAGCGCGTCCGGACGTTCCCGTCGCTACCTCATTTGCA
GCAGGTGACGAGACCCTCGGCGTCACTGCTGCTTGCGACGCCCCCGCCGTCGTTGTTCCCCATGCCCGGGCCGTTAGCGGCGACAAGTACAATACCAGGT
AGTGCGGCGTCGGGACTGCCTACGGTTGCTAGTGCAGTTGCCGCGGCGGCCACGAGACCGACGCCCATCATGCCGTCCGTGAGTTTGCCGCTGCCGAACA
ACGCACTGGCGGCTCTGCCGATGGCACCCCAGCAACCGCCACGGACGCCGATCGTGCTCCCACCAGCGCACCGTTCGCTTCCGCCACTGCCGGATTTCTT
AAACAGCCGCGAAGCCTTAACCCCGCTACTGCCGCCGCTGCGTCTGCAGTTAATACGACACGCGCTTCCCGACCTTCGAGCAGTGCTA