Transcript Name :
Phyra_g2223
Orientation:
(-)
Number of Exons:
9
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Tetratricopeptide repeat-containing domain12.023PS50293
Tetratricopeptide repeat-containing domain8.082PS50293
HmmSmart predictionP-Valprediction_id
Tetratricopeptide repeat69SM00028
Tetratricopeptide repeat0.84SM00028
Tetratricopeptide repeat0.29SM00028
Tetratricopeptide repeat310SM00028
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1144
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        5259 bases(100 bases per row)
TGTCGGCGAGCATGCTCCGGCAGATGCTAGTGGACGCCGCGGCCTTCCTCAAGGCCGAGCGCTACCAGGAGGCGCAGGACGCAGGCCGCCGCGTGACGCA
ATTTGACCCCAACAACTTCCAGGCCTTCATGTGTGTGGGGCTCGCCAGCTTCCACCTGCAAGAGGTGCGTCTGCAGGATACTGTACCCCAATGTGTAACC
CATACTAACCATACTTTGCTGCCAGTGGGAGGACTGCGAGGACGCGTATCGCCGAGCGGCAGATATCAAGCCCGAGATGCCGGCGCCCTGGAAGGTGCAG
AGCGTGGTGAGGGTTACTTTAGGTTGCAGACTGGAGACTGATTCTCTGCTGCGGTTTTGCAGTACCTTGTGGACCTTTTCGAGGCCAAAACGGATGTGAA
GAGCAAGTTGGAGCCACTGGAGAAGCTCGTGGACATCAATTTGAGGTACTGCAAACTGAGGAGACCTGGGTGGACCTTTTGTAGACTGATACCTGTTGTA
TTTGCAGGGGCAAGAAGATCAAGAGGTGCCAGAAGTGGGTAGCGGAGGTGGCGGCTACTGCAATGGAGTTGAAGATGCTCCCGAAGGTGGAGTAGCTTTA
TGGCTACGTTAATAAGATAGTGTATACTCATTTTTTGTGCTTTGATGTAGACCTTTGACTCGTGGTACTCCCTTGTGGGGGGACTGGATGGAGATGTTGG
ACAGCTTTCGCTCGAGAAAACTGCGAACGAAGAATTACCGGCCCCGCTGAATATCTGGCTGGATTTGGTGGATTTGCTGCAGGTATGTATTTTGTTGTTG
TTGCTATGCTGTCTGGCGTGGATATTGAAGGTTCTTGATACAGCGTCCTGGGTTCAGCTTATCGGACTGCTCTGGCAGCTACTCCATGCCAGAAATCTCT
CGTCACGTGTTCGCCGTTGCATCTCGTACTGATTGGACAGCTCAGAATGAAGAGATTGATGCGCTCCGTCCACGAATGGATGCCGCAATCGCGTTCTTTA
TGCGCTTTCACCTGGATGCACTGAAGGCTTCCAAAAAGAAGCCCACGCTCCTCAAGACGGTCGATGCATTGGCGACGACAATCATCGAGTGGTTTCCTGG
TTCCAAGATTCCGGCAGAGTTCCTATTACTCCGCAGTGAAGACCAGGATAGTCGTACGTATTCCATGCGTACTATTGTCTGTCGACTTTGCTAATTGTTG
GCGGAGCTGATGCATTGTTGCTGATGGTGTTTGAAAACGGGTAGCTATTACTTTGGATAAGGCGAGGGAAGTCGCGGCTGGGCTATTTGCAAGCCATTCC
AGGAGTCCTATGGCTCTTGTGTTTCAAGCGGTGGAGTACTTGCGCCTCGGAAAGAGTAACCAGGCAAGTGGTTGACTCTATCGGCATTGCTGTTAACAGT
AAGTTCTGACATGCGTTTGGATTACTAGGCCCGAGAGATCTTTGTGGAAGCCCTCGCTGGTTACTCCTCCTCTTCTTTTCAAGAAAGCTCTCTTTGCATT
CGTGCTCAAGTCGAGTTGGCATCACTGGCACTTGCAGCCCGCGATGTAGAGGGTTGCTTGAATCGTCTGTCCTTGGCCAAAAAGGTTGTGACTGACAAGG
CGAAATTGCTTGGGTGTGAAGACCCGCTTCCATCTCTGTAAGTTATCAACGCCTACCATTGTTGCCTTTGACGTACAATGACTCTGGTCTATTTGAAATG
GTACAGGTATTCGGAAGTCAAGGTGCTGTTCATGGCGGCAACGGCGTGCGAGTACTCGGGTGACGTGGATAGAGCGTTAGAGAACTACCGCGGAGTCATG
GGAAGTGACGACCTTCTTCTCATGGTAAAAGCGGCCATCGCAGCGGCAGAGCTATTGACTACCAAGGCGCAGTCAAAGGAGGCTCTCGAAGTCATTGACT
CCGTTTCTTTGTCTGAAGTGGGGGACGAAAGCGTGTGTGCTGCTGTGCTGTGCACCCGTGGGTGGATTCAATTCCAACTTGGCGACTTCCAACAAGCCCA
AGCGCTGCTAGAGGCAAATGCGAGCAAGATTCCAGCCACTGATGTTTTCGCTAAGGGGCGAACGCTGAAGCGATTAGCAGTTGTGTACTGGCACCTAGGC
GGTTCTCATCAAAGTGCAAAACCAGGGTGCTTTGCCCATCTACTACAAGCCGCGAAGCTGACGCCATCCGACGCGGAGATCTTCTCATGGCTGGGTAAAT
GGTACCAAGAAGTCGCAAAGGATATTTTGCGTGCCGAAAAGTGTTTCTTGAAGGCACTTTCGCTTTCTCCCACCGATGAGTTGGCAGGAATGGCTCTAAG
CAGCCTGTACGATCTACAGGGAAAGTATGGCGCGAACGTGGAACTATGGGAACGAGTGACTGAGGACCAAGAAACTGCTCCGACATGGGCGCTCCTGAGA
CTGGCTCAGCACCTGGTGGAACAAAACGACGAATTGGCAGTGGGAAAAATGCATCTCGTGCTGCGTAATAACCCTATGAATGCCCGTTATTGGGTTATTC
TGGCACATATCTACCAGAACTTCGACAAGCACGTTTCCGCGCAGAGGTCTTATTTGAAAGCCATCGAGCTGGGTGAGGAAAACTGGTGCGTTCGTTGTGA
GCTGGCTCGGATTGAAGGCTCATTGCTGCTTTTCGACGATGCGTTGGATAGAATCAAACCGGTTGTCACTGGTGAATTATCCGATGGCAAGCCAGACGTG
ACTGTCGCATCCATGATCTATGCCGACCTGCTTTTCCAACAGGCAAAATACTTATGTGCTGAGGGATTATATGGCAATGCTGCTGCGAATCTGAAGGAGG
CGTCCCGAATGATGAAGGGACTTCCGTCCACGTCAGCCCTCTCTGGGTCTGTGGAAGCGTGCAAGCTAATCGGTGATATTCACTGCTTCGCTTTCTACTT
GTCGCCAGACAACTTTTCAAGCGAAGGCTCAAGCTGGGTTGATTTCATCAGCGCTGGGAGGAAGGCTTACGAAGCTGCTGCTTTACTAGCTGAAAGGGGC
GAAAAAAAGACAGTGGGTGGTCCTGACGCTGTCGCCGCAGAGCGATTTTATGATATCGGTCTAAGCTATTGGTACGAAGCTCAGGCTCTCAGCAACGTGC
GCGGCATCCCCAGTTCAGCTTTCTCTATCGAAAAGGGTCTTGCCAACAGTGACGCAGATGCTACACTCTCGAAGCTAAAGGCGAAAACGTCGACGAATTT
CAAGTTGGCCCTTCAGGAGGATCCTTCGTGCTCGCTGGCCTGGAATGGATTGGCACTTGTGTCTGACAGTCTGCTGGTGAAGCAGTTTGCCTGGGCACGA
GCAGTCCAAACCGGCAGCAGTAGCGATGCCACATGGGCCAATTTGGGCATGTTTTACCTCAGCCAAGCTGATGCCGTGCCATCAGCGGCGTCGTTGGCGC
AGAAGTCGTTTCTGCAGCTGCAGAGCGTGAACCCAAGCAACCCATCTATGTGGAATGGGTATGCGATGCTGGCTCGACGCCAAGCTAGCTCAACGGTTCA
GCAGAGAAAAGCGATCGAAGCATTCGACTGTGCACTGCAAGTCGGGTTGGATCTGGATGCTCTGCTTGGCTTAAGCACGGCATTGTTGGACTATGGAGCT
AGTGTCGGTGAGTCGATAACGGAGGCTCCAGAGCATGATAGCGAGCAGGTGATGTTTTACCTGAAGAAGTATTTAGAACGAGACCCGTTCAATGCGCGCG
CTTGGCACGCTCTAGGTGTTGCTCAGCACCGCCTCGGACTGTACACCGAGGCTTTGGCGTCCTACACCCATGCGGCTTCGTCTGCTCGTGACCAAGAAGG
CCTTGAATGGAATACGCTAGTGACTGAGCTTGGCCAGCTCTCCGATAAATCTTGCGATGGAATTGACGATTCAGCGCTTTTGCAAAAGATTGCCGCGACG
AGTGGGTCCTCAGCACTTCAGGGTATCGTGCAAGCGCAGCTACTATACCGTCAATCAAAGGGAGGCGAGGCGCTGGATTTGCTTCACGCGTTGATTCCAC
GAGATGAAGCCCAGTCCGCTGAGAGTAATGTCGTTGCGCTTGTGGGTCTATCGATGGCGAGCTTGCTCATGAGCAAGTTTGGCTCCAAGGCAGTGGGTCT
TGCAGCAGTGTGTAAGGAGCGTCTTTTGTCCTCAGTTGACCAAGCTGATTCAACGCTCACAACGCGCGATTATCTGAACCTGCACTTGGTTGAGCTCCAC
GAACGCTTTGTGGGCGCTGAAGATGCTTACCTGACGCGCCTTCAAGCGCTGTCGCAAACCAATGACGGAGCGAATTCAAGTTCGCTATGGATGCGTCTGG
CTCTAGCGACGATCGACTCGCAAAACCTTCAAGTGTCGAGTTGCCTGGGAGAGTATTTGCGTTCGACTGCCAGAAATGTGCCTTCCCCTGGCAAGGACAC
GGTGGATCGCAACTTCTTGGACTCGTTGGTGGGATTGTTCAAGGCTGGCCCATCCGGGGTAAAGGGGCTGTGTTTGGACGCACAAAAGTTAATTCGCGCC
CAGCCGTGGAATTCACAGGCATACGTTCTGGCTGGCACAAGCATCCTCAAGCGCATTGGTCTGGAAACGAAGCGAGAAACGCACCATGACGTTCTTCGTC
ATCTGCTGCGCTTGCTGCAGACCGGATTGTCACTTGCTATTGCCGCAAGTGGGCGAGACTATGATGCAGCTCAGTTGGAGCTCCTGACGAGCTACTGCTA
TGCCAAACTCGGAGAACACGATCAAGCAACATCGTTTTCAATCGAAGGACTGACTCGAGTTAAAGAAAGCAAGAAGAGGGGCGCTCTGACAGACTCGGTG
GACACTGACCTGCTGGAAGCACGTCTGCTATCGATCTCAAACCCGGCAAAGGCCGTTCAGAAGTACGTGGACGTTGTTGCTGCCGTCTCTGCCGATACTG
CTGCTGCTGCTTCGAGCCGATTGGTTCCAATCCTGATTGAGCTCGGAGGGTTTTATGAAGAACAGCAATCCTTGGACGCTGCAATCAACGTGTGGAAGCT
CGTTGCTTCATTGACGGCGACCAAGTTTATCACCTCGGCAGATGCTGATGACGATGTGAGCAGCACGACCACCGCCTTAAGCAGCAACAGTGATACTGCT
ACTTGCTTCTTGGCGAATTTGCGGCTTGCACTTATCCACGGCAAGAAGAACAACGTGAAGCCGGCTCGCAAGCACATCAAGGTGGCGCTAGCGCTAGCCG
AAGCTGGGTCGGACTCGTCCACTGTTGCGGCGTTCGTCGAGAACGTCCTCGCTAACTAG