Transcript Name :
Phyra_g8784
Orientation:
(-)
Number of Exons:
6
Description :
XP_008911542.1 GTP-binding protein TypA/BipA [Phytophthora parasitica INRA-310
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Elongation factor, GTP-binding domain0.0000000000000055PR00315
Elongation factor, GTP-binding domain0.0000000000000055PR00315
Elongation factor, GTP-binding domain0.0000000000000055PR00315
Elongation factor, GTP-binding domain0.0000000000000055PR00315
Elongation factor, GTP-binding domain0.0000000000000055PR00315
*** None ***
HmmSmart predictionP-Valprediction_id
Translation elongation factor EFG, V domain0.0063SM00838
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Translation elongation factor EFG, V domainIPR000640
*** None ***
InsideOutsideTMhelix
1-627
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
GTPase activityGO:0003924IEA
*** None ***
*** None ***
Sequence
        2329 bases(100 bases per row)
TGTGGCTCCGTCGGTCCTGCCTGCCTGCCCTGGCGCGCGCGCGCTCGGGCCAGCGCTCGATACTGCAGCGCAGCGCGCCCACGCTGGCGTGCGCCTTCTC
CACCGACTATTCGGCCGTCACGGCTGAGAACATCCGCAACGTGGCCATCGTGGCGCACGTTGACCACGGCAAGACCACGCTGGTGGACCAGTTGCTCAAG
CACGGCGGCAACACACTCTCCGAGGAGCGTGTCATGGACTCCATTGACCTGGAGCGCGAGCGCGGCATCACCATCATGTCCAAGTGCACGCGCGTCGAGT
ACAACGGCCACGTGCTCAACATCGTGGACACGCCCGGTCACGCCGACTTTGGCGGCGAAGTGGAGCGCATCCTGAGTATGGTGGACGGCGTGGTGCTGGT
CGTGGATGCCACGGAGGGCCCCATGTCGCAGACCAAGTTTGTCCTGACCAAGGCGCTGCACCGCGGACTGAAGCCACTCGTCGTTGTCAACAAGGTGGAC
CGCGACACCAGCCGTCTGGATGGATCTGTGGAGAACGAGCTCTTCGACATGTTTGTGGCGCTTGACGCCGACGACGACCAGCTGGAGTTTCCTGTGCTGT
ATGCGTCAGCGAAACAGGGCTGGGCCGTGCACGACCTGGACAACGGTGAGGCGCGTGACAGCATGCTGCCGTTGCTGGACGAGATCACTCGCTACGTGCC
TGCTCCAGAAGCTACCGCCGACAAACCGTTTGCGATGGCCGTCACAATGATCGGACACGACCCGTACGTCGGCCGTCTGGCGACAGGCCGCGTACACGCC
GGAACTGTCAAGGTGGGCTTGGCTCGTTCTAGATGATGCTCTTGCACTTCGTACTGACTTTTGAATGTGCCGCGCTTTTTCACTGTGCCATTGACTAGAT
TGGCGACTTGATTCAAGTGATGAACCGCGAGAGCAAGAAGCTTGAGACTGGCAGAGTGACTAAGATGTTCGTGACCCGTGGTGTTTCGAAGTCGGAGATC
ACGTCGGCTACCGCTGGTATGTTTGAGAGCATCACTCTTTTATGCTTGAAGGCGTTTGCATGCTAATACTTCATGTTTTGTGCATAACTCGTTGTAACAG
GTGACATTATCACCATTGCTGGTGTCAACGCGTATGTGTCCGACACCATCGCTGACGTGGCCGTGACGGAGCCGATTCCCTCTCCGCAGCTGGACCCGCC
CACGATTTCCATGACGTTTGGTGTGAACGATGCGCCGACCGCAGGCAAGGATGGAGTTCCTCACATCTTCTCATATCAAGCAGCGCCTTGAGCGCGAATG
CGAGGTCAGTGGGATCTTGCTTTTCTTACTTTTTTGTTGAGCTGAGTGATTCACTGATGAATGATTGTGTATTGATGTCTTCAGAACAACGTTGCTATCT
CCATTTCTCAAAGTAAATCGTCGGAGGCCTTCGATGTGCACGGCCGTGGTGAGCTTCAGCTTGCTATTCTGATTGAAGAAATGCGTCGTGAGGGCTTTGA
GATGTCTGTCTCAGCCCCCCAGGTGCTCTTCCAGACGGACCCGGAGACCAACCAGAAGTTGGAGCCTATCGAAGAAGTGACGATCGATGTCGACTCCGAT
TTCTCTGGCACGGTTATTGACAAGCTGGCGACCCGTGGTGGTGAGATCATCGAGTTCAAGGAGATGCACGACAAAGTGCGCCTCCAGTTCAAGATTCCCA
GTCGCTGTCTCATGGGCTACCGCAGTGAGGTGCGTAAATGCGTTGAATCCGAGCACTTTTCTCGAATAAGGACTTACTCTGGATCATGTTTCCTATGTGT
AGATCAAGACTGACACTCGCGGAAGTGGAATTCTGAACTCGATTTTCCACGGCTACTCGCCGTTCCAAGGCTCGGCTACTCCTCCGTCGAAGGGCAAGCT
TATCTCCTCGTCTGGAGGCATGTGCACGGTAAGATGATAGCTTAAATGTACGATCGTTCGTGCCCCCAATCCTATTTACTCAATATGGCTTGCTGGAAAC
AGGCTTACGCGTTGAACACGCTTGAAGACCGCGGAGAGATGTTCGTGAAGCCTGGTGACGAGGTGTATGAGGGTATGATCGTGGGTGAGCACAGCCGCCC
TACGGACATTGAGATCAACCCCACCAAGGAAAAGAAGCTCACCAACATGCGTGCTGCCGGCACGGACGAGAACGTCAAGCTGTCTCCGATCCGCGTGATG
TCCCTGGAAGATGTTGTGACCTACATTGGCGAGGACGAGATGATCGATGTGTCCCCGACCAAGATCCGCATGCGAAAGCGCGAGCTCACCGCCAACGGCC
GCAAACGCGTGCAGGGCAAGAAGAAGTGA