Transcript Name :
Phyra_g31
Orientation:
(-)
Number of Exons:
1
Description :
OWZ12961.1 Pectate lyase [Phytophthora megakarya
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Pectate lyase/Amb allergen0.00000065SM00656
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pectate lyase/Amb allergenIPR002022
*** None ***
InsideOutsideTMhelix
1-400
NN-scoreoddsWeighted Score
0.6665.8690.012
*** None ***
TypeScore
mitochondrial34.8
GO
*** None ***
*** None ***
*** None ***
Sequence
        1202 bases(100 bases per row)
TGCAGTTCTTCCGTCCCATTCTCATTGTGGTGGTGGCTATCGTGGTCCAGGCCACGGACGCCTTCACGGTCGGATCGGCCACCGGTCTCGCTGCCGGAAC
CACAGGCGGAGGCAGCGCCACCCCCGTGTACCCCACCACGACGGCGCAGCTCGTCGCGTACCTAAAGGACGCCGTGCCCCGTGTCATCGTGCTCAACAAG
ACGTTCGACTTCCGCGGCACGGAGGGCACGACGACCGAAGCTGGTTGCCGCCCAGACTACACCCGGGAGTGTATCGCCAAGAACAATGGCTACAAGAGCC
AGGATGTCATCCTGCAGAGCGGTGGCATGTCCAACACGGGTGGCTGCTCGGACGGCACCAGCGTGACGGTCACGTACGACAACGCAGCCATCACCCCACT
CACGGTGACTGGCAGCAAGACCATCCGCGGCATTGGCACGAGCGGTGTCATCATGGGCAAGGGTCTGTGGCTGAACGGCGACAATATCATCGTGCAAAAC
ATCCACATCACGGAGCTCAACCGCCACTTGGTGTGGGGTGGCGACGCCTTCTACATGCAGGGCAGCAACGGCGGCTCGACGGCCATGAACAAGATCTGGC
TGGACCACATCAAGGTCTCCCACGTCGGCCGTCAGTTCTTGACGACGAACGCCGCCAGTGTGTCCACGATGACCATCAGCAACTCGGACTTCGACGGCCG
CACGGACTACTCGGCTACGTGTGACGGTCGCCACTACTGGTCCTTCATCTTCTACGGCAAGAACACCCGCTTCAGCATGCTCAACAACTACGTTCATTCA
ACATCGGGACGCTCGCCCAAGATCGGTGGCGACAGCAGCGCCAACGTCGTCGCGCACATCGCCAACAACTACTGGGCGGACAACTCGGGCCACTCGTTCG
AGATCGGCGTCAACGCATGGGTGCTCGCCGAGGGCAACTACTTCCAGGACACGACGCTGCCGCTGCTGACCGGCTCGGATGGCGCCCTCTACGCCGCCAC
CGCCACCACCGAGTGCAACAGCTACCTCGGTCGCTCCTGCGCCGCCAACGTGGTAGACAACAGCGGAGCGTTTCAGTCCCGCAACGGTGCGACGGCTCTA
TCCACGGCAAAGTCGTACTCGGCCATCTCCAGCTACAGTCCGAGCGCGGCGAAGAAGCACAGCAAGACCACCAACAACTTCGGCATCGGCGTGCTCAACT
AA