Transcript Name :
Phyra_g15
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Ubiquitin1.2e-16PR00348
Ubiquitin1.2e-16PR00348
Ubiquitin1.2e-16PR00348
Profile scan predictionP-Valprediction_id
Ubiquitin domain25.378PS50053
HmmSmart predictionP-Valprediction_id
Ubiquitin domain5.4e-24SM00213
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
UbiquitinIPR019956
*** None ***
InsideOutsideTMhelix
1-77
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        437 bases(100 bases per row)
ATGCAGATCCAGATCAAGGTACCCACGCCCCCACGCCGCGATCACAGGGGCTGGAAGGGTACTAATAAGTGTGTTTATTGCGCTGGTGTAGACGCTCACT
GGCCGGAAGCAGACGTTCAACTTTGAGCCGGACAACACGGTACGATGCGATATTCTGGCGCTTCGGACGGTGTGATACTGACGTTGTTTCTCCTTCCGTG
AACAGATCCTGCATGTGAAGCAGGCCCTGCAGGAGAAAGAAGGTATCCAGGTGGACCAGATTCGTCTCATCTACAGTGGCAAGCAGCTGTACGTGGAGTT
AGTCTTGAAACGATGAGCTAGACACGGATGTTGATGGCCTTGCTGCTCTACAGAGCCGATGACAAAACGTTGCAGGACTACAACGTGGCTGCGGGCGGCA
CCATCCATATGGTGCTGCAGCTGCGTGGCGGGTGCTA